Describe how decomposers link the living and non-living parts of an ecosystem

2 answers:

8 0

Decomposers are living organisms that breaks down other living and non-living things into smaller parts.

Decomposers can recycle dead plants and animals into chemical nutrients such as carbon and nitrogen that are released back into the soil, air and water as food for living plants and animals.

kherson [118]3 years ago

8 0

Decomposers are living organisms that breaks down other living and non-living things into smaller parts. ... Decomposers can recycle dead plants and animals into chemical nutrients such as carbon and nitrogen that are released back into the soil, air and water as food for living plants and animals.

Decomposers play a critical role in the flow of energy through an ecosystem. They break apart dead organisms into simpler inorganic materials, making nutrients available to primary producers.

Decomposers, such as bacteria, fungi, termites, and earthworms, are scavengers that feed on the organic material found in dead producers and consumers. They break down the organic material to the nutrient level. Nutrients in soils are essential for producers to grow. Nutrients include nitrogen, carbon, and phosphorous. Thus, dead consumers (and producers) are recycled back into new producers.

You might be interested in

A population of 2,000 birds has an annual per capita birth rate of 14/100, an annual per capita death rate of 9/100, and an emig

kifflom [539]

14 i did that quiz last week

8 0

3 years ago

In 1665, robert hooke examined a thin slice of cork using a simple microscope. Hooke observed tiny box-like cavities that were e

Setler [38]

Robert Hooke observed the thin slice of cork cells present in the plant cells. In 1665, Robert Hooke referred these empty tiny box-like cavities as cork cells.

<h3>What is Robert Hooke's Observation?</h3>

In 1665, Robert Hooke used a microscope to examine a tiny box-like empty cavities which are referred to as cork cells. He observed that the cork was made up of tiny units that looked like a honeycomb. He referred to them as cells, and he was the first to find a dead cell. This observation has a major contribution in the cell theory.

Hooke published his results under the title Micrographia, about his microscopic observations on several plant tissues. He is remembered as the coiner of the word “cell,” referring to the cavities he observed in thin slices of cork. The cork cells protect the tree from bacterial or fungal infection. It prevents water loss through the bark.

Learn more about Cells here:

brainly.com/question/3142913

#SPJ1

7 0

1 year ago

Which theory suggests that the universe continues to look the same throughout, with the old stars and

vodka [1.7K]

Answer:

I believe it is Hubble's law but I could be wrong

6 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein