Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
If you were charged for collateral protection insurance on a Wells Fargo auto loan, you could receive a cash payment from a class action settlement.
This statement is TRUE.
This is because if something happens to the collateral in the hands of a lending institution, you can receive compensation and this is known as Notice of Proposed Settlement of Class Action (“Notice”) and is authorized by the government.
<h3>What is collateral protection insurance?</h3>
This refers to the type of insurance that insures property that is on hold as collateral by a financial institution.
Hence, we can see a class action settlement has to do with the proceeds of financial rewards that is gotten as a result of winning a class action lawsuit and involves payment to a defendant.
With this in mind, we can see that you can receive compensation and this is known as a Notice of Proposed Settlement of Class Action (“Notice”) if you proceed with a class action lawsuit.
Read more about collateral protection insurance here:
brainly.com/question/14307346
#SPJ1
Organisms are connected to the nonliving environment because one, organisms depend on nonliving things to help Organisms survive. Another reason would be because both need each other. Like, Organisms would rely on nonliving things for resources, food, and safety.
Answer:
<h2>Liver, testosterone </h2>
Explanation:
The cholesterol is an important type of organic molecule that has many important roles in organisms. It is a sterol that is also called a modified steroid. It plays an important role in the cell membrane of the organism. Generally, it is synthesized in the liver and some other parts of the body. The synthesis of cholesterol is regulated by a homeostatic mechanism. Testosterone is synthesized from the cholesterol so cholesterol acts as starting material. Testosterone plays an important role in the development of the reproductive tissues of the male.
