1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yarga [219]
3 years ago
6

How do you think fossils form?

Biology
1 answer:
marissa [1.9K]3 years ago
6 0
Fossils are formed in different ways, but most are formed when a plant or animal dies in a watery environment and is buried in mud and silt. Soft tissues quickly decompose leaving the hard bones or shells behind. Over time sediment builds over the top and hardens into rock.
You might be interested in
Which statement is true of human cultures? O A. All human societies share the same cultural traits and practices. O B. Every hum
emmasim [6.3K]

Answer:

B. Every human has a unique set of cultural traits and practices.

Explanation:

Culture can be defined as the general way of life of a group of people living together in a particular location or society.

Basically, culture comprises of beliefs, values, behaviors, language, dressing, cuisine, music, symbols, arts, social habits, knowledge, customs, laws pertaining to a particular group of people living together in a society.

This ultimately implies that, culture are acquired and passed from one generation to another.

A cultural trait can be defined as the smallest characteristics of human activity (actions) that is mainly acquired socially and transmitted from one generation to another through various modes of communication.

This ultimately implies that, these unique behavioral informations or characteristics and beliefs acquired by people socially are transmitted from one individual or group of people to another.

Hence, the statement which is true of human cultures is that every human (race) has a unique set of cultural traits and practices that were acquired from the environment and society.

6 0
3 years ago
To determine
kvasek [131]
بالصراحة ما بعرف وأنا كمان ما اعرف
4 0
3 years ago
Pls, I need help with this! Biology Thank you :)
topjm [15]

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

8 0
3 years ago
Someone pls pls help for 30 points
NemiM [27]

Chemical Weathering.

Brainliest would be appreciated.

7 0
2 years ago
Similar patterns of embryological development in different but related organisms are most likely due to similarities in their
leva [86]

Answer:

fsaf

Explanation:

dsdadsda

7 0
3 years ago
Other questions:
  • A family of raccoons living in the center of the forest leaves that area and joins a population of raccoons living near the edge
    10·1 answer
  • Birds use their beaks to rub their feathers with oil secreted by the?
    10·1 answer
  • What is the meaning of photosynthesis ​
    14·2 answers
  • What are the main features of a eukaryotic cell?
    15·1 answer
  • Why is the use of stem cells so controversial?
    5·1 answer
  • A segment of DNA is called a (n)?
    9·1 answer
  • How does the changing coat of a weasel help it survive​
    7·1 answer
  • Protists are a group of organisms that are characterized as eukaryotes (they have cells with nuclei) that are neither plants nor
    16·2 answers
  • in a strike-slip fault, the rocks on either side of the fault slip past each other sideways with little a. noise. b. shaking. c.
    9·2 answers
  • In the absence of oxygen, glycolysis is followed by _________ in human cells
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!