Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer: Scientific notation- 
Explanation: I got this by moving the decimal, so that there is one non-zero digit to the left of that decimal point. Tip- The number of decimal places you move will be the exponent on the 10.
Moved right- Negative
Moved left- Positive
Answer: The answer is D.
Explanation: The warm water will cause the sugar to dissolve quicker.
Answer:
1.09 L
Explanation:
There is some info missing. I think this is the original question.
<em>Calculate the volume in liters of a 0.360 mol/L barium acetate solution that contains 100 g of barium acetate. Be sure your answer has the correct number of significant digits.</em>
<em />
The molar mass of barium acetate is 255.43 g/mol. The moles corresponding to 100 grams are:
100 g × (1 mol/255.43 g) = 0.391 mol
0.391 moles of barium acetate are contained in an unknown volume of a 0.360 mol/L barium acetate solution. The volume is:
0.391 mol × (1 L/0.360 mol) = 1.09 L
An accepted and universally true explanation of observed facts is a law.
