1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maks197457 [2]
3 years ago
11

If someone could please help me I would appreciate it “I did not mean to put 4”

Biology
1 answer:
grin007 [14]3 years ago
5 0
I think 1? Not sure which is boy and which is girl but
You might be interested in
In 3–5 sentences, compare and contrast the flow of matter and energy in each
trapecia [35]

Answer:There is a fundamental difference in the way energy and matter flows through an ecosystem.Matter flows through the ecosystem in the form of the non-living nutrients essential to living organisms. When a living organism dies, nutrients are released back into the soil. These nutrients then are absorbed by plants, which are eaten by the herbivores. Matter, once again, is passed on. The herbivore is eaten by a carnivore (and matter is yet again transferred therein). Ultimately, when the carnivore dies, matter is returned back to the soil by the decomposers and the cycle repeats. So you see, matter is recycled in the ecosystem.Unlike matter, energy is not recycled through the system. A part of the energy is lost at each stage.

Explanation:

5 0
3 years ago
What are the abiotic and biotic factors of a Beach Coastal?
ololo11 [35]

Answer:

Beaches have specific abiotic factors like sandy, rocky soil, high amounts of sunlight, strong wind, high salinity and changing tides. Despite these challenges many biotic factors survive, such as mangrove trees in tropical areas, and flat, sprawling succulents in sand dunes.

7 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Which is the function of space observatory technology?
igomit [66]
Space Observatory Technology. Space observatory is any instrument in outer space which is used for observation of distant planets, galaxies, and other outer spaceobjects. A large number ofobservatories have been launched into orbit, and most of them have greatly enhanced our knowledge of the cosmos.
5 0
3 years ago
Read 2 more answers
Characteristics of the alexandrium catenella?
professor190 [17]

Answer: Alexandrium catenella is a species of dinoflagellates. Alexandrium has two flagella that enable it to swim. While one flagellum encircles the cell causing the cell to rotate and move forward, the other extends behind the cell and controls the direction.

The cell wall is composed of cellulose Theca.

Length 20 - 48 μm, width 18 - 34 μm

Yellow-green to orange-brown

Forms chains of 2, 4 or 8 cells

4 0
3 years ago
Other questions:
  • Carbohydrates are important in the body because they contribute to the body's ability to
    8·2 answers
  • Once a person is infected, which one of these sexually transmitted infections (stis) remains in the body for life, regardless of
    7·1 answer
  • Insects are usually _______.
    13·1 answer
  • The annual world seafood catch grew from approximately 19 million tons in 1950 to approximately 90 million tons in 1997. As a co
    6·2 answers
  • Explain why predators and prey with many generations of interactions are likely to have pronounced behavioral responses to each
    15·1 answer
  • Which describes the correct pairing of DNA bases?
    8·2 answers
  • Question 28 of 30
    11·1 answer
  • No mate repaired a.asexual reproduction b.sexual reproduction c.both
    11·2 answers
  • Describe the type of information a 3D image provides that a 2D does not ?
    13·1 answer
  • PLEASE HELP I only have tomorrow morning to get my grade up.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!