Answer:There is a fundamental difference in the way energy and matter flows through an ecosystem.Matter flows through the ecosystem in the form of the non-living nutrients essential to living organisms. When a living organism dies, nutrients are released back into the soil. These nutrients then are absorbed by plants, which are eaten by the herbivores. Matter, once again, is passed on. The herbivore is eaten by a carnivore (and matter is yet again transferred therein). Ultimately, when the carnivore dies, matter is returned back to the soil by the decomposers and the cycle repeats. So you see, matter is recycled in the ecosystem.Unlike matter, energy is not recycled through the system. A part of the energy is lost at each stage. 
Explanation:
 
        
             
        
        
        
Answer:
Beaches have specific abiotic factors like sandy, rocky soil, high amounts of sunlight, strong wind, high salinity and changing tides. Despite these challenges many biotic factors survive, such as mangrove trees in tropical areas, and flat, sprawling succulents in sand dunes.
 
        
             
        
        
        
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
 
        
             
        
        
        
Space Observatory Technology. Space observatory is any instrument in outer space which is used for observation of distant planets, galaxies, and other outer spaceobjects. A large number ofobservatories have been launched into orbit, and most of them have greatly enhanced our knowledge of the cosmos.
        
                    
             
        
        
        
Answer: Alexandrium catenella is a species of dinoflagellates. Alexandrium has two flagella that enable it to swim. While one flagellum encircles the cell causing the cell to rotate and move forward, the other extends behind the cell and controls the direction.
The cell wall is composed of cellulose Theca.
Length 20 - 48 μm, width 18 - 34 μm
Yellow-green to orange-brown
Forms chains of 2, 4 or 8 cells