1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
trasher [3.6K]
3 years ago
9

What came first? The chicken, or the egg?:3​

Biology
2 answers:
timurjin [86]3 years ago
7 0

Answer:

easy

Explanation:

the egg obviously

Novay_Z [31]3 years ago
3 0

Answer:

egg lol

Explanation:

hi :p

You might be interested in
Bipedal walking is more energy efficient
Vinvika [58]

Answer:

C. When running that is the answer

6 0
3 years ago
Read 2 more answers
Zaznacz wszystkie przystosowania płazów do życia tylko na lądzie. Uwaga: niektóre opisy dotyczą przystosowań do życia zarówno w
Gekata [30.6K]

Translation in English:

Check all amphibians' adaptations to life only on land. Note: Some descriptions refer to adaptations to life both in water and on land

The webbing stretched between the toes of the hind legs.

A Nostrils located on the upper side of the head.

B Hind legs long and well-muscled.

C Gas exchange through the lungs.

D Eyes protected by lids.

E The body is covered with a thick layer of mucus.

Answer:

And someone else can figure out the answer I need to leave but I would say the answers are  B, C, and D

Polish Translation:

Tłumaczenie na język polski:

Sprawdzaj przystosowania wszystkich płazów do życia tylko na lądzie. Uwaga: Niektóre opisy odnoszą się do przystosowań do życia zarówno w wodzie, jak i na lądzie

Taśma rozciągnięta między palcami tylnych nóg.

Nozdrza znajdujące się w górnej części głowy.

B Tylne nogi długie i dobrze umięśnione.

C Wymiana gazowa w płucach.

D Oczy chronione przez powieki.

E Ciało pokryte jest grubą warstwą śluzu.

Odpowiedź:

Ktoś inny może znaleźć odpowiedź, której potrzebuję, ale powiedziałbym, że odpowiedzi to B, C i D.

7 0
3 years ago
__________ system: the body system responsible for fighting diseases; arsenic, methylmercury, and dioxins can weaken this system
fomenos
The immune system. 

The immune system acts as a defense system of the body. It fights against bacteria, viruses and any other disease causing pathogens. Some chemicals can weaken the immune system and make them vulnerable.
6 0
3 years ago
________ the dolphin lives in the sea, it is not a fish - it's a mammal.
lina2011 [118]
 Although the dolphin lives in the sea, it is not a fish - it's a mammal.

It makes the most sense if you read it aloud. 
7 0
3 years ago
Because atoms of elements in the same group of the periodic table have the same number of neutrons, they have similar properties
ikadub [295]

The answer is true Hope this helps

8 0
3 years ago
Other questions:
  • What does a population graph with a J curve show?
    8·2 answers
  • Name at least three physical properties of the bowling<br> ball.
    9·2 answers
  • A high fever causes an enzyme to lose its three dimensional structure and function. Which bonds are broken when a protein denatu
    12·1 answer
  • Which best describes the ovary? It produces progesterone. It does not influence breast development. It produces testosterone. It
    5·2 answers
  • Arrange the following in the correct sequence, from earliest to most recent, in which these plant traits originated. 1. sporophy
    11·1 answer
  • Explain the processes that take place in the stroma including the reactants going in and the products produced from these proces
    12·1 answer
  • you have selected the following prediction to test: Previously thinned forests will have higher tree survival than adjacent fore
    15·1 answer
  • N
    8·2 answers
  • Breaking a phosphate bond in an ATP molecule releases
    13·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!