1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Afina-wow [57]
3 years ago
8

People who live in rural communities (country side) impact the ocean. A True B False

Biology
1 answer:
Vlad [161]3 years ago
4 0
True, extreme weather events, sea level arise
You might be interested in
Predict how doubling the length of the sides of a cube-shaped cell would affect
Minchanka [31]

Answer:

Increasing the size of the cube-shaped cell increases the volume. However, the surface area-to-volume ratio decreases. This means that the simple diffusion would take more time distribute nutrients across the cell (and even in the eliminate waste). It would need bulk transport such as vesicle transport, otherwise cell activities would slow down.

4 0
3 years ago
A type of glycocalyx called the _______ is loosely attached to the bacterial cell and protects it from dehydration and loss of n
IrinaVladis [17]

A type of glycocalyx called the slime layer is loosely attached to the bacterial cell and protects it from dehydration and loss of nutrients .

<h3>What is glycocalyx ?</h3>

The glycocalyx is a thick outer covering of the plasma membrane .it is of stands of sugars and proteins bound together ,the result is a thick ,sticky layer that helps cells stay put in environments with lots of physical stress .it is a glycoprotein and glycolipid covering that surrounds the cell membranes of bacteria ,epithelial cells and other cells .

Glycocalyx in humans : it is important to both vascular function and the digestive system . your blood vessels actually tiny tubes made of cells .the cells on the very inside of the tube are called endothelial cells and have to withstand the stress of blood flowing over them constantly. endothelial cells produce a glycocalyx which helps leukocytes and thrombocytes stick to blood vessel walls.it is the protective layer of the endothelial cells found in the lumen side of the vessels .

Glycocalyx in bacteria : most of the bacteria produce glycocalyx but some are expert .these expert bacteria make a very thick glycocalyx that helps them to adhere to each other and surfaces in extreme environments .bacteria use the glycocalyx to make thick films of bacteria in nature as well ,called a biofilm .

Learn more about glycocalyx here:

brainly.com/question/5590059

#SPJ4

3 0
2 years ago
The genes for miniature wings (m) and garnet eyes (g) are approximately 8 map units apart on chromosome 1 in Drosophila. Phenoty
Luden [163]
<h2>Answer is option " 2 & 4"</h2>

Explanation:

  • Two types of posterity can be created subsequent to mating: parental and recombinant. Recombinants are created because of the traverse of non-sister chromatids at the hour of gamete arrangement. Here, mating happens between m+g/mg+ female and mg/mg male so the posterity would be separated as follows:  
  • m+g/mg : Parental  
  • mg+/mg : Parental  
  • m+g+/mg : Recombinant  
  • mg/mg : Recombinant  
  • m+g+/mg (wild sort) and mg/mg (smaller than usual wings, garnet eyes) are the recombinants thus they were created because of the hybrid occasion.
  • Hence,the right answer is option 2 & 4 "wild type and miniature wings,garnet eyes"

7 0
3 years ago
Which of these is a sign of a chemical pollutant in crop plants? A. Reddish patches on leaves B. Yellowing of leaves C. Wilting
Mashcka [7]
A. Reddish patches on leaves
8 0
3 years ago
Read 2 more answers
PLS help me with my biology HW, I forgot what the answer was!
Sunny_sXe [5.5K]

Answer:

Contracted blood vessels

Explanation:

The volume of blood is reduced as the vessels are more narrow due to the contraction, so less blood reaches the respiring tissues, causing the force of blood flow to increase as there is less space for normal blood flow to occur. This means that blood pressure increases.

7 0
2 years ago
Other questions:
  • How are histone modification enzymes (such as HATs) and chromatin remodeling complexes recruited to unmodified chromatin, and ho
    5·1 answer
  • For a species with four pairs of chromosomes, ________ gametic combinations are possible
    5·1 answer
  • The hormone found only in pregnant women that, when detected, confirms pregnancy is
    7·1 answer
  • Can a nerve cell be found in the g0 phase
    8·1 answer
  • If a new species of plant is to be produced by means of allopolyploidy from two parental species that are 2n = 6 and 2n = 8, how
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • A template strand of DNA in a gene reads:
    11·1 answer
  • Canicas y piedras son homogéneas o heterogéneas
    10·1 answer
  • Read the quotation below from a high school science student.
    10·1 answer
  • EXPLAIN How have advancements in computer technology most directly influenced our
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!