1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Soloha48 [4]
3 years ago
14

What is one use of hydrogen?​

Biology
2 answers:
GalinKa [24]3 years ago
6 0

Answer:

However, hydrogen is useful as an energy source/fuel because it has a high energy content per unit of weight, which is why it is used as a rocket fuel and in fuel cells to produce electricity on some spacecraft. Hydrogen is not widely used as a fuel now, but it has the potential for greater use in the future. So there you have it!

Explanation:

Have a great day, also branliest maybeee-

Molodets [167]3 years ago
5 0

Answer:

early all of the hydrogen consumed in the United States is used by industry for refining petroleum, treating metals, producing fertilizer, and processing foods. U.S. petroleum refineries use hydrogen to lower the sulfur content of fuels.

Explanation:

You might be interested in
Select three sports that require participants to be highly fit before the beginning
tangare [24]
I believe the answer is C. E. And F.
4 0
3 years ago
Read 2 more answers
What does it mean for a membrane to be selectively permeable?
maw [93]

Answer;

Semi-permeability means that only certain molecules are allowed to pass through.

Explanation;

-Semi-permeability is one of the features of a cell membrane, which means that the membrane allows selective movement of materials in and out of the cell; that is only certain molecules can enter or leave the cell.

-For example smaller molecules such water and ions such as potassium and sodium ions are able to leave and enter the cell, while other molecules that are large such as protein molecules can not enter or leave the cell.

3 0
3 years ago
Read 2 more answers
Looks like fluffy cotton ball
kiruha [24]
What looks like fluffy ball?
WHAT DOES?
4 0
3 years ago
What is the purpose of grid paper in your investigation? (1 point)
MrRissso [65]

What was the investigation? But from my best guess I'm assuming it's the second option. This may be incorrect.

7 0
3 years ago
Why are single-stranded binding proteins necessary for DNA replication?
Margarita [4]

Answer:

d.They prevent the two parental strands from coming together again.

Explanation:

During the process of DNA replication, the two DNA strands should be separated from each other to serve as a template. To separate the two DNA strands, the helicase enzyme breaks down the hydrogen bonds between the complementary base pairs of the DNA strands. The process uses ATP as a source of energy.

Due to the presence of complementary base pairs, the separated DNA strands have a tendency to reanneal by the formation of hydrogen bonds. To prevent the reannealing of separated DNA strands, single stranded binding proteins bind to them. Binding to single stranded binding proteins to the separated DNA strands does not allow them to reanneal.  

8 0
2 years ago
Other questions:
  • Sb-22 when must you maintain a proper lookout by sight and hearing?
    14·1 answer
  • What term best describes a failure of the body's cells to respond to secretion of insulin?
    9·1 answer
  • A ________ diet restricts or eliminates foods that are hard to chew and swallow.
    7·1 answer
  • What leads to competition between two species?
    9·1 answer
  • Organ where pancreatic enzymes and bile enter the alimentary canal
    8·1 answer
  • Which organelle contains chemicals that break down substances in the cell?
    12·1 answer
  • Double-jointedness occurs when there are two joints between bones that are normally governed by one joint
    5·1 answer
  • PLEASE ASAP! GIVING BRAINLIEST!
    14·2 answers
  • haw are living organisms department on the soil?are organisms that live in water totally independent of soil as a resource​
    10·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!