1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
prohojiy [21]
3 years ago
10

What does the suffix -zygous mean? (Genetics)

Biology
2 answers:
Sloan [31]3 years ago
8 0

Answer:

relating to the word zygous

i.e. heterozygous

Sindrei [870]3 years ago
5 0

Answer:

Having a zygotic constitution of a specified kind:heterozygous.

You might be interested in
When are electrons able to be pushed and move freely
Mariulka [41]
No lo se pero buen día ciela pásala rico
4 0
3 years ago
The organisms that harness non-biological energy and convert it to biologically relevant/useful energy are called __ 1 __ _. The
mamaluj [8]

Answer:

The organisms that harness non-biological energy and convert it to biologically relevant/useful energy are called __<u>autotrophos or producers</u>_. The organisms that consume these are called _<u>herbivores</u>_ (it should end in -ores) which occur at the __<u>second</u>_ trophic level. The number of trophic levels that any ecological system will primarily dependent on the _<u>consumer</u>_ organisms.

Explanation:

 In the trophic web occurs energy transference through organisms occupying different levels in the chain. Each level feeds on the preceding one and becomes food for the next one. The first link is occupied by autotroph organisms, which are the producer. The following links are the consumers: herbivores are primary consumers and feed on producers. Carnivores are secondary consumers and feed on herbivores, and so on. The last links are the decomposers, microorganisms that act on dead animals degrading organic matter.  

Every link has an effect on the superior links and the immediately anterior link, meaning that whenever one of the links changes, the other ones will be affected.  

Autotrophs or producers synthesize inorganic substances, such as light, and turn them into organic matter according to their own needs. These organisms are photoautotrophs, such as plants, or chemoautotrophs. They occur at the first trophic level.

Heterotrophs are those incapable of producing their own organic matter, so they feed on producers, depending on them to get proteins and energy. In the trophic chain, heterotrophic organisms occupy the first, second, or third consumer level, after producers. These animals can be herbivorous, carnivorous,  omnivorous, hematophagous, ichthyophagous, and etcetera. All of them depend on autotrophic organisms.

In the particular case of herbivores, they occur at the second throphic level feeding on producers and being eaten by carnivores.

In general, most trophic chains are composed of 4 or 5 levels, depending on the number of consumers present, and the energy transference between levels.

8 0
2 years ago
The spinal cord transfers messages from the brain to the _______________________
Nesterboy [21]
I think the awnser is d
8 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
What is bipedalism? Give one example of an organism with bipedalism
mash [69]

Bipedalism is a form of terrestrial locomotion where an organism moves by means of its two rear limbs or legs. 

(ostrich, human etc. )

5 0
3 years ago
Read 2 more answers
Other questions:
  • A client informs the nurse that he wants to discontinue his treatment and go home. later, the nurse finds the client dressed to
    8·1 answer
  • Rising sea levels are a possible global consequence to a change in local environments. Please select the best answer from the ch
    12·1 answer
  • What are cloud seeding?
    8·1 answer
  • 5. Suppose a non-native species of beetle is
    14·1 answer
  • BRAINLIEST!!PLEASE HELP ME!!
    6·1 answer
  • Competitive exclusion does not result in _____.
    12·2 answers
  • Mr. Bondi suggests there doesn't have to be some chaotic event, such as an explosion, to explain the origin of the universe. Our
    5·2 answers
  • Describe how building a dam for electricity affects an ecosystem.
    7·1 answer
  • in all plant and animal cells the nucleus contains long molecules of DNA which of the following best describes the function of t
    7·1 answer
  • If i were to jump off a cliff without bending my knees, would i break my legs and/or my spine??
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!