1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Delvig [45]
3 years ago
13

When investigating drug or toxin presence, which category of presence is appropriate when

Biology
1 answer:
grigory [225]3 years ago
8 0
The answer would be D i believe
You might be interested in
A patient diagnosed with amyotrophic lateral sclerosis has increasing muscle weakness in the upper extremities. the physician or
adell [148]
In the current procedural terminology, the person should look for electromyography or needle or extremities and will be directed to the code range 95860-95864. Code selection is based on the number of extremities studied. In this case, two extremities are studied in making 95861 the correct code selection. Amyotrophic lateral sclerosis or ALS is also known as lou gehrig’s disease. In the ICD-10-CM index to diseases and injuries, which the person must look for sclerosis or amyotrophic or lateral. It is directed to code G12.21. 
3 0
3 years ago
Describe how your peripheral nervous system and central nervous system were involved in simple activity you performed today
dezoksy [38]
<span>The central nervous system (CNS) and peripheral nervous system (PNS) work together in a multitude of ways. The (PNS) is ultimately the extension of the (CNS)</span>
5 0
3 years ago
What type of muscle tissue is on the chicken wing
sergejj [24]

Answer:

Tendons

Explanation:

5 0
3 years ago
Read 2 more answers
Pieces of Earth's crust move on top of the: Group of answer choices outer core ocean inner core mantle
AnnZ [28]

Answer:

mantle

Explanation:

6 0
2 years ago
What would a solar eclipse look like if the Moon were smaller than it is now?
Step2247 [10]

Answer

Explanation:

the moon would have to be closer to the earth for it to perfectly align with the sun, or if it were smaller it would look like a circle with a smaller black circle in the middle.

3 0
3 years ago
Other questions:
  • What is the term for the result when a single chromosome containing one strand of DNA divides itself into two new chromosomes an
    8·1 answer
  • Which of the following is a unit of measurement in the metric system?
    9·2 answers
  • 6 main zones of the marine biome
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Classify the following characteristics to describe the differences between continuous and discontinuous feeders.
    11·1 answer
  • Put "Genetic Variation" in a sentence
    14·2 answers
  • Which kind of rock forms when molten rock from underground moves to the
    12·1 answer
  • Where a stream leaves a mountain range youll find an?​
    8·1 answer
  • How is nominal scale type related to diversity?
    6·1 answer
  • 5) Explain in your own words, what each of the following are:
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!