Ten mL of gasoline has a mass of 7 grams. What is the density

Marine biologists in the Gulf Coast completed a population sample for Orcinus orca, commonly known as the Orca whale. The resear

siniylev [52]

i think the correct answer of this qusion is 55

8 0

2 years ago

You are studying two linked genes that influence vine height and fruit color in squash. Yellow color is dominant over green, and

Strike441 [17]

Answer:

22 map units

Explanation:

Linked genes may be defined as the genes present on the same chromosomes and they are inherited to the next progeny. The linked genes produces the recombinant progeny.

Distance between the linked gene = No. of recombinants / total number × 100.

Here the parental are 198 Tall Yellow, 192 Short Green.

The recombinant progeny are 54 Tall Green, and 56 Short Yellow.

Distance = $\frac{54+56}{198+192+54+56}\times100$

Distance = $\frac{110}{500}\times100$

Distance = 22 map units.

So, the distance between the genes are 22 map units.

8 0

3 years ago

How do animals obtain energy to grow?

Colt1911 [192]

Answer:

Animals get their energy from the food they eat. Animals depend on other living things for food. Some animals eat plants while others eat other animals. This passing of energy from the sun to plants to animals to other animals is called a food chain.

Brainliest pls? owo

8 0

3 years ago

Read 2 more answers

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

3 years ago

Cells and the organisms they make up reproduce through cell division. Some

Virty [35]

C cause they won’t be identical to the parent since they are reproducing sexually

7 0

2 years ago