1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalija [7]
3 years ago
13

Some argue that solar power should be the main energy source for the United States. Which argument could be used against this id

ea? A. It contributes to global warming. B. It can only be produced in sunny areas. C. It is a nonrenewable resource. D. It releases greenhouse gases.
Biology
1 answer:
docker41 [41]3 years ago
5 0

Answer:

A. It contributes to global warming

Explanation:

  • Solar power is the power of the future and is an essential nonrenewable source of energy for man. Solar power is driven by the incoming solar energy in the form of solar rays.  
  • Solar power is eco-friendly and doe not cause any harm can be sued in the summer season and has ample scope for greenhouse gases.
  • As per the statement, the solar power should be used as the main energy source in U.S can be contradicted by saying it contributes to global warming.
You might be interested in
How do our bones enable movement
Montano1993 [528]
Muscles,tendons,ligaments,and cartilage 
6 0
3 years ago
How are a heterozygous and a homozygous individual different?
Sidana [21]

Answer:

Option (a).

Explanation:

Homozygotes individuals has the same genotype whereas the genotype of the heterozygotes are different. The homozygotes may refer the true or pure organism.

The gametes obatined from the homozygotes caaries the same gene. The gametes of the heterozygotes carries the different version of the gene. The dominant trait will express themselves in the heterozygotic condition.

Thus, the correct answer is option (a).

7 0
3 years ago
What do you think is meant by the statement, "DNA unites all organisms"
NARA [144]

Answer:

Easy. All life on this planet are products of DNA. It is what we all have in common.

8 0
2 years ago
The sun is the primary source
Sedaia [141]

The Sun is the primary source of energy for Earth's climate system is the first of seven Essential Principles of Climate Sciences.

Principle 1 sets the stage for understanding Earth's climate system and energy balances.

The Sun warms the planet, drives the hydrologic cycle, and makes life on Earth possible.

5 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • Which is source of energy for photosynthesis
    7·1 answer
  • DNA can be found in all cells EXCEPT which of the following?
    15·1 answer
  • Complete the following statements to accurately describe examples of organisms affecting the Earth’s atmosphere, and subsequent
    8·1 answer
  • In a cross of purple flowered heterozygous plants (Pp), the letter P represents the allele for purple flowers and the letter p r
    12·1 answer
  • Some scientists theorize that this behavior developed from the tactic of throwing smaller eggs to break them open. ostrich eggs,
    9·1 answer
  • Every cell in an organism contains DNA that is what
    15·1 answer
  • 20. Ventricles are the _______ chambers of the heart. A. bottom B. top C. smaller D. middle
    11·2 answers
  • The Hoover Dam in Nevada, supplied by Lake Mead, generates hydroelectric power for several western states, including the numerou
    11·1 answer
  • During exhalation the air pressure on the outside of the lungs is (greater than / less than) the air pressure
    7·1 answer
  • Identify two types of anaerobic respiration and describe where and when they occur
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!