1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blababa [14]
2 years ago
15

Which element does this Bohr model represent? (look at a periodic table if needed)

Chemistry
1 answer:
Serjik [45]2 years ago
6 0
Circulating round the nucleus are the electrons in various orbits of different energy levels. Electrons are negatively charged and represented by the symbol 'e'. In the given image the number of protons are -6. Hence the element in question is Carbon as Carbon has the atomic number 6.
You might be interested in
How GM food are produced?​
Nana76 [90]

<em>What is genetic modification (GM) of crops and how is it done? GM is a technology that involves inserting DNA into the genome of an organism. To produce a GM plant, new DNA is transferred into plant cells. Usually, the cells are then grown in tissue culture where they develop into plants.</em>

3 0
3 years ago
Read 2 more answers
Can someone help me out plz
rosijanka [135]

Answer:

#2 you multiply the numbers

Explanation:

5 0
3 years ago
2. Why does the CDC recommend hand sanitizers with at least 60% alcohol?! I
choli [55]

Answer:

Here's it:

Explanation:

Germs are everywhere! They can get onto hands and items we touch during daily activities and make us sick. Cleaning hands at key times with soap and water or hand sanitizer that contains at least 60% alcohol is one of the most important steps you can take to avoid getting sick and spreading germs to those around you.

There are important differences between washing hands with soap and water and using hand sanitizer. Soap and water work to remove all types of germs from hands, while sanitizer acts by killing certain germs on the skin. Although alcohol-based hand sanitizers can quickly reduce the number of germs in many situations, they should be used in the right situations.

3 0
2 years ago
Burning gasoline is an _____________ reaction.
rusak2 [61]

Answer:

chemical.............

5 0
3 years ago
Read 2 more answers
sing any data you can find in the ALEKS Data resource, calculate the equilibrium constant K at 25.0°C for the following reaction
prisoha [69]

Answer:

2.76 × 10⁻¹¹  

Explanation:

I don’t have access to the ALEKS Data resource, so I used a different source. The number may be different from yours.

1. Calculate the free energy of formation of CCl₄

                         C(s)+ 2Cl₂(g)→ CCl₄(g)

ΔG°/ mol·L⁻¹:       0         0         -65.3

ΔᵣG° = ΔG°f(products) - ΔG°f(reactants) = -65.3 kJ·mol⁻¹

2. Calculate K

\text{The relationship between $\Delta G^{\circ}$ and K  is}\\\Delta G^{\circ} = -RT \ln K

T = (25.0 + 273.15) K = 298.15 K

\begin{array}{rcl}-65 300 & = & -8.314 \times 298.15 \ln K \\65300& = & 2479 \ln K\\26.34 & = & \ln K\\K& = & e^{26.34}\\&= & \mathbf{2.76 \times 10}^{\mathbf{11}}\\\end{array}

3 0
3 years ago
Other questions:
  • Which of the following animals exhibits bilateral symmetry?
    14·2 answers
  • Which element has only two half filled orbitals in the 3D sub level
    9·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which of the following pairs of elements could possibly be found in the same group on the periodic table? (2 points) A forms a 2
    5·1 answer
  • The following substituents are listed in random order. Using the Cahn–Ingold–Prelog convention, rank the groups below from highe
    6·1 answer
  • Calculate the enthalpy of the reaction 2NO(g)+O2(g)→2NO2(g) given the following reactions and enthalpies of formation: 12N2(g)+O
    12·2 answers
  • "Give an explanation of the combustion reaction of octane."
    6·1 answer
  • Chemical properties of group one elements
    9·1 answer
  • Help!!!plz help me with this question ​
    10·1 answer
  • 3.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!