1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reika [66]
3 years ago
9

Koalas are marsupials that are found in eastern Australia. Although their ancestors lived mostly on the ground, modern koalas sp

end most of their time in eucalyptus trees. This is possible because their hands and feet have strong claws and opposable digits. mc018-1.jpg What other adaptation could have helped koalas as they evolved from land dwellers to tree dwellers? the ability to have several offspring at one time fur color that closely matches the eucalyptus bark color longer hind legs that allow for faster running better ability to communicate with their peers
Biology
2 answers:
Leokris [45]3 years ago
6 0

The correct answer is fur color that closely matches the eucalyptus bark color

Earlier kolas used to live on land but now most of the that are found in eastern Australia spending most of the time on the eucalyptus trees and it is possible only because their hands and feet have strong claws and the opposable digits. The color of the fur of koalas are same to the bark of the trees of eucalyptus. This adaptation will help them to protect themselves from the predators.

Lubov Fominskaja [6]3 years ago
5 0
The answer is fur color that closely matches the eucalyptus bark color
You might be interested in
How does eternal dermal tissue help plants that on a hot day?
JulijaS [17]
It keeps the water in the plant, so it keeps the water from evaporating and killing the plant
6 0
3 years ago
Which fossil organism in whale evolution was the first to live mostly in water?
balu736 [363]
During the research Ambulocetus would be the first to consistently stay in water and Set over time they developed feet arms and <span>hands used to swim.</span>
5 0
3 years ago
Which of the following is a characteristic of science?
allochka39001 [22]

Answer:

A it investigates the super natural.

7 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
What is still lacking in the hypothesis of an asteroid impact as the cause of the end-cretaceous mass extinction?
Doss [256]

A convincing explanation of why some lineages survived while others vanished is still lacking in the hypothesis of an asteroid impact as the cause of the end-cretaceous mass extinction.

<h3>What is an asteroid?</h3>

One of the smaller planets in the inner Solar System is an asteroid. Asteroids are metallic or rocky bodies without an atmosphere, ranging in size from 1-meter pebbles to a dwarf planet with a diameter of over 1000 km.

The majority of the one million or more known asteroids are concentrated in the main asteroid belt, which is 2 to 4 AU from the Sun and between the orbits of Mars and Jupiter. The three categories of asteroids that are typically recognized are C-type, M-type, and S-type.

These were given their names and are frequently associated with, respectively, carbonaceous, metallic, and silicaceous compositions. The largest asteroid, Ceres, has a diameter of over 1,000 km (600 mi), making it a dwarf planet.

To learn more about an asteroid with the help of given link:

brainly.com/question/11996385

#SPJ4

8 0
1 year ago
Other questions:
  • Carbolfuchsin used in the original acid fast stain consisted of 0.3 g basic Fuchs in 10 ml 95% ethanol 5ml phenol and 95 ml wate
    14·2 answers
  • The best description of the greenhouse effect is that it _______.
    12·2 answers
  • Which of the following accurately describes carbon atoms?
    15·2 answers
  • Why do wilting of leaves take place in hot summer days?
    5·2 answers
  • A gated channel in a cell membrane allows
    12·2 answers
  • As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs? The tRNA that was in the A site m
    6·1 answer
  • Why is transcription essential for making proteins
    7·2 answers
  • Biogeography is the study of the
    9·1 answer
  • How would the following table be most helpful? How would the following table be most helpful? *
    14·2 answers
  • 5514998054 ps 123456​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!