1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leya [2.2K]
2 years ago
7

Please help! Will mark brainiest for the most helpful answer!

Biology
1 answer:
yulyashka [42]2 years ago
3 0

Answer:

upper one is translocation and lower one is deletion

Explanation:

You might be interested in
What is plant ????<br><br>ASAP​
Lera25 [3.4K]

Answer:

a living organism of the kind exemplified by trees, shrubs, herbs, grasses, ferns, and mosses, typically growing in a permanent site, absorbing water and inorganic substances through its roots, and synthesizing nutrients in its leaves by photosynthesis using the green pigment chlorophyll.

Explanation:

5 0
2 years ago
Read 2 more answers
Membrane structure what molecules make up a membrane
geniusboy [140]
<span>The principal components of the plasma membrane are lipids (phospholipids and cholesterol), proteins, and carbohydrate groups that are attached to some of the lipidsand proteins. A phospholipid is a lipid made of glycerol, two fatty acid tails, and aphosphate-linked head group.

</span>
7 0
3 years ago
Duck-billed platypus is called a bridge animal, why?​
xxMikexx [17]

Answer:

The platypus serves as a 'bridge' animal between nonmammals like birds and reptiles, which maintain their testicles in their body cavity, and placental and marsupial mammals, which hold their testes in an external scrotum."

4 0
2 years ago
What is the main difference between aerobic respiration and anaerobic respiration?
garri49 [273]
The main difference between aerobic respiration and anaerobic respiration is that aerobic using oxygen in the reaction, while anaerobic does not.

Even though both aerobic and anaerobic respiration releases energy, but their reactants and other products are completely different.
For example in human, in aerobic respiration, oxygen and glucose reacts to give out carbon dioxide and water; while in anaerobic respiration, which usually happens during exercise when oxygen is not enough, the muscle cells uses only glucose to produce energy and lactic acid.

Therefore, the main difference is where aerobic uses oxygen, and anaerobic don’t.
7 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • explain how the threat of Extinction of some rainforest plant species could also be a threat to humans. (Please Help)
    6·2 answers
  • How does lead poisoning affect the nervous system?
    10·1 answer
  • Which of the following enables a cell to pick up and concentrate a specific kind of molecule?
    13·1 answer
  • So why don’t we get pink flowers if we combine the genes of a Red Dominant flower with a white recessive flower?
    5·2 answers
  • a person with type O blood is often called the universal donor why might this be a good time to use to describe such a person
    7·1 answer
  • Andrew noticed Michael and his pregnant wife Georgette walking down the street and drove his car very close to Michael, and honk
    8·1 answer
  • 4. A paper mill clears an area of deciduous and coniferous trees. A small pond forms on the newly cleared land as
    9·1 answer
  • Please I’m begging you please help
    12·1 answer
  • Which would scientists predict might happen due to solar flares?
    6·1 answer
  • What are acellular organisms​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!