<span>The strength of the gravitational force between two objects depends on two factors, mass and distance. the force of gravity the masses exert on each other. If one of the masses is doubled, the force of gravity between the objects is doubled. increases, the force of gravity decreases. you can look it up in Google</span>
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
Explanation:
1-butanol has 4 carbon atoms with an OH group at the first carbon atom.
Dichlorodifluoromethane has 1 carbon atom with 2 chlorine atoms and 2 fluorine atoms.
I have no idea, but i’m pretty sure you gotta divide
Answer:
l = 0, 1, and 2; it is in a d orbital.
Explanation:
1. Angular momentum quantum number
One square means l = 0.
Three squares mean l = 1.
Five squares mean l = 2.
If an atom contains electrons with l = 2, it must also have electrons with l = 0 and 1.
Thus, the electrons in the atom can be assigned the angular momentum quantum numbers l = 0, 1, and 2.
Those in a set of five squares all have l = 2.
2. Location of electron
The last electron is the lone electron in the fifth square. Since l = 2, the electron is in a d orbital.
