Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Probability of Green seed * Red flowers * Green pods
3/4 * 3/4 * 3/4 =27/64
Answer:
D. Chlorophyll
Explanation:
Chlorophyll is important as it allows the plant to convert carbon dioxide and water into glucose.
The bones in your arm are a structure that first appeared in lobe fin fishes, such as the Eusthenopteron fish.
let me know if you have any other questions
:)
B I think is the answer sorry if I’m wrong