1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PSYCHO15rus [73]
3 years ago
10

PLZZZZZ HELP MEH!!!!!

Biology
2 answers:
Ira Lisetskai [31]3 years ago
7 0

Answer:

i'm pretty sure it's the endoplasmic reticulum

Explanation:

TEA [102]3 years ago
3 0
The answer is B. Endoplasmic reticulum
You might be interested in
The relative humidity would be ________% if the actual water vapor in the air was 10 grams per cubic meter, the air's capacity t
lys-0071 [83]

Answer: The Relative humidity is 50%

Explanation: Relative humidity is the ratio of the air’s water vapour content (the actual amount of water vapour in the air) to its water vapour capacity at a given temperature. It depends on temperature and the pressure of the system of interest and it is usually expressed in PERCENTAGE; the higher the percentage, the more humid the air/water mixture.

The formula of Relative humidity (%) = (water vapor content / water vapor capacity) x 100%

Where: Water vapour content is the actual amount of water vapour in the air. Which is 10g/cm³ from the question above;

Water vapour capacity is the air's capacity to hold water vapour. Which is 20g/cm³ from the question above.

Therefore, RH(%)= (10g/cm³ / 20g/cm³) x 100 = 0.5 x 100= 50%

This means that the air contains half of the water vapour it could hold at 20 degree Celsius.

5 0
3 years ago
Read 2 more answers
How many bases make up the code for amino acid
Scorpion4ik [409]
3 bases make up the code for amino acids
5 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Where does transcription occur in a cell?
Veronika [31]

Answer:

In the nucleus

Explanation:

8 0
3 years ago
Read 2 more answers
Unlike in prokaryotic cells, replication in eukaryotic cells
8_murik_8 [283]
<span>A. can start in many different places on a sequence at the same time. </span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • The universe tends to move to a state of entropy or A: disorder B: organization C: mediocrity
    12·3 answers
  • Which cell process controls the way materials enter and leave the cell?
    12·1 answer
  • The process by which oxygen and carbon dioxide are exchanged between cells blood and air is called
    15·1 answer
  • Explain why natural selection cannot occur in a population that has no variation in traits.
    5·1 answer
  • How do metalloids relate to metals and nonmetals?
    11·1 answer
  • Why did the water take on a dome shaped, and not a flat one when on the wax paper?
    10·1 answer
  • The arrow is pointing to the<br> in a plant cell.
    13·1 answer
  • What type of mutation has the least amount of impact on a protein ?
    13·2 answers
  • What is similar about fermentation and phtotsynthesis.
    8·1 answer
  • What keeps intracellular receptors from binding to dna before a hormone binds to the receptor?.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!