1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
r-ruslan [8.4K]
3 years ago
9

Why does pollution stay within the earths atmosphere

Biology
1 answer:
kykrilka [37]3 years ago
7 0

Answer:

pollution doesn't nessairly stay in the atmosphere, it is moved throughout the atmosphere and can be removed by a natural process.

You might be interested in
How do the outer layers of cells on the underside of a leaf work to gather carbon dioxide?
RSB [31]
The only way for gases to diffuse in and out of the leaf is through small openings on the bottom of the leaf, the stomata.
5 0
3 years ago
The name propionibacterium is derived from the fact that the organism produces propionic acid during fermentative metabolism. wh
Alex_Xolod [135]

Basing on the information given, fermentative metabolism is a type of anaerobic metabolism that does not use oxygen to produce ATP or bioenergy.Thus, this where its name derives from.  Thank you for your question. Please don't hesitate to ask in Brainly your queries. 
4 0
3 years ago
How can an event that blocks sunlight from reaching earth cause a mass extinction of consumers on Earth?
anyanavicka [17]

B. Consumers depend on producers to make food using sunlight. This is the right option.

6 0
3 years ago
Read 2 more answers
WILL GIVE BRAINLIEST ANSWER AND THANK YOU!!!
insens350 [35]
composite, female, incomplete, multiple, monocot.

Btw can you help me with a question?
6 0
3 years ago
Read 2 more answers
Why did Mendel study pea plants?
tamaranim1 [39]

Answer:

He chose peas because they had been used for similar studies, are easy to grow and can be sown each year.

Explanation:

I just saw the answer on the website :)

(≧▽≦)( ꈍᴗꈍ)

3 0
2 years ago
Other questions:
  • How does stewardship fit into the web of life?
    12·1 answer
  • What is representative sample
    14·1 answer
  • How does the structure of alveoli maximize gas exchange?
    9·1 answer
  • This is an inherited characteristic that increases an organism’s chance of survival
    15·2 answers
  • How can new information about DNA help taxonomists
    6·1 answer
  • 9. Iron (Fe) is an element found on the Periodic Table. Iron's atomic number is 26.
    9·1 answer
  • plant reproduction requires the presence of auxins, as well as a large amount of sugar for energy. which two main plant tissues
    11·1 answer
  • A wealthy elderly couple dies together in an accident. A man comes forward, claiming that he is their long lost son and is entit
    10·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Can environment and heredity impact your personal health
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!