1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erik [133]
2 years ago
15

Some factories have started using large tanks of bacteria to remove carbon dioxide from the atmosphere. As more factories start

to do this, the amount of carbon dioxide in the atmosphere could decrease over time. If this happens, and if energy coming from the sun and the amount of carbon dioxide being put into the atmosphere otherwise stay the same, what would happen to the total amount of energy in the Earth system and to global average temperature
Biology
1 answer:
Softa [21]2 years ago
6 0

Answer:

The carbon dioxide in the atmosphere will be reduced if more factories started using bacteria to capture carbon dioxide

Explanation:

There will be more that will reach the Earth System than exited as combustion introduced carbon dioxide to the atmosphere, so the total amount of energy in the system will increase.

You might be interested in
A science classs is studying an organism. Using a microscope, the class observed that the cells have nuclei and chloroplasts. In
const2013 [10]

Answer:

Eukarya

Explanation:

According to the given information, the observed cells have nuclei and chloroplasts. The presence of a well-defined nucleus and other membrane-bound organelles such as chloroplasts is a feature of eukaryotic cells. All the eukaryotic organisms are assigned to the Domain Eukarya. Therefore, the observed cells belong to the domain Eukarya. Due to the presence of chloroplasts in them, these cells may belong to the kingdom Plantae of domain Eukarya. Domains Archaea and Bacteria include prokaryotic organisms.

5 0
3 years ago
During dna replication, the enzyme dna polymerase adds new nucleotides to the ______ end of the sugar in the growing strand
NeTakaya

<em>During dna replication, the enzyme dna polymerase adds new nucleotides to the </em><em>3</em><em>'</em><em> end of the sugar in the growing strand</em>

4 0
1 year ago
The zone is the point along the shoreline between the highest high-tide line and the lowest low-tide line.
svlad2 [7]

Answer:

Inter-Tidal Zone

Explanation:

This area is known as the inter-tidal zone, where the animals must be able to withstand the sun's heat and the ocean.

5 0
2 years ago
Individuals with delusional disorder differ from those with schizophrenia in that
harkovskaia [24]
<span>the Individuals with delusional disorder will have delusions but they don't have hallucinations, thought disorder, mood disorder, or significant flattening of affect. schizophrenia patients will loose the touch with the reality and they will have hallucinations etc.</span>
8 0
3 years ago
A fungal _________ is light enough to be carried for miles in the wind, dispensing the fungus to new areas.
Gemiola [76]

Answer:

a. spore

Explanation:

Fungi is a kingdom in which you can fund yeast, mold, and all kind of fungus, microcellular, and monocellular ones.

The way fungi reproduction is through spores that get distributed in a latent way until thy fund its necessary conditions to living.

These spores can create both ways, sexual and asexual.

7 0
3 years ago
Other questions:
  • Why is commensalism important? Why is it necessary for ecosystem?
    7·1 answer
  • A type of organic farming that focuses on creating a sustainable environment is called agriculture.
    7·1 answer
  • Which of the following enables a cell to pick up and concentrate a specific kind of molecule?
    13·1 answer
  • Which process requires no energy from the cell
    5·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which is the biggest muscle in the human body?
    7·2 answers
  • Solomon is studying for class. To remember the term _____, he uses the analogy of a thermostat in a house. For instance, when th
    14·1 answer
  • Help please
    15·1 answer
  • Soil erosion can be reduced by
    9·1 answer
  • COMPLETE LA SIGUIENTE TABLa <br>​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!