Answer:
buffer zone
Explanation: a small(ish) strip of land that isn't sprayed between the cultivated plot and the water to filter out the chemicals and stop it from reaching the water
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
The answer is Both features have a recessive phenotype in these offspring.
An individual's phenotype is defined by their genotype and expressed genes, as well as apparent traits such as hair colour or type, eye colour, body shape, and height. It is determined by the genotype, but it is also modified by environmental circumstances.
What is genotype?
- The genotype of a person can reveal their genetic makeup.
- It determines which qualities will be expressed.
- Organisms with similar appearances do not share the same genotype.
- Biological tests can be used to determine a person's genotype.
To learn more about genotypes visit:
https://brainly.in/question/97090?referrer=searchResults
#SPJ4
Answer:
Modern human are called as Homo sapiens.
Explanation: Following are the characteristics of the modern human skull-
i) They have projecting nose bone and comparatively small face.
ii) Eye sockets are square in shape.
iii) the neck muscles are reduced.
iv)The skull is round at the back.
v) Their cranial capacity is 1350 cc. Earlier they had a cranial capacity of 1500 cc.
vi) There has no narrow constriction behind the orbits.
