1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gayaneshka [121]
3 years ago
7

What are California's major mineral resources

Biology
1 answer:
GenaCL600 [577]3 years ago
4 0

Answer:

The term mineral resources includes minerals plus various types of rocks and sediment it also includes products made from these materials. California's major mineral resources include sand, gravel, crushed stone, building stone, gold, silver, iron, evaporite minerals, and clay.

Explanation:

You might be interested in
Which of the following is a major function of the cell membrane?
dybincka [34]

Answer:

the answer is A

Explanation:

the cell membrane is like a shield to the cell.

6 0
3 years ago
The principle of competitive exclusion states that A. two species cannot coexist in the same habitat. B. competition between two
larisa86 [58]

The principle of competitive exclusion states that two species cannot coexist in the same habitat.

<h3>What is competitive exclusion?</h3>

The competitive exclusion principle, often known as Gause's law, is a theory in ecology that holds that two species competing for the same scarce resource cannot coexist at constant population levels. One species will eventually outnumber all others if it has even a modest edge over the others. This results in the weaker competitor's extinction or an evolutionary or behavioral shift in favor of a different ecological niche. The adage "complete competitors cannot coexist" is a paraphrasing of this idea.

Although he never created it, Georgy Gause is traditionally credited with coming up with the competitive exclusion principle. The natural selection theory put forward by Charles Darwin already incorporates the concept.

The status of the principle has fluctuated during the course of its history between

To learn more about competitive exclusion from the given link:

brainly.com/question/2083056

#SPJ4

5 0
1 year ago
Which of the following statements describes an example of natural selection?
nignag [31]
An aloe vera plant possessing a trait for extra thick leaves survives very long droughts in deserts, while and aloe vera plant that doesn't have thick leaves doesn't.
7 0
3 years ago
Read 2 more answers
An adult human body consists of about cells
Ber [7]
Here you go look off of this

4 0
2 years ago
how is translation initiated? view available hint(s)for part a hint 1for part a. how is translation initiated? the start codon s
Irina18 [472]

The Translation initiated is <u>Option D.All of the listed answers are correct. </u>

At the initiation of translation ribosomes and tRNA bind to the mRNA. tRNA is located at the first docking site of the ribosome. The anticodon of this tRNA is complementary to the start codon of the mRNA where translation begins. After binding to the mRNA, the ribosome initiates translation at the start codon AUG and moves the mRNA transcript one codon at a time until it reaches the stop codon.

When tRNA recognizes and binds to the corresponding codon in the ribosome, it transfers the corresponding amino acid to the end of the growing amino acid chain. tRNA and ribosomes then continue to decode the mRNA molecule until the entire sequence is translated into protein. tRNA acts as an adapter molecule during the translation process. Formerly known as soluble RNA or sRNA. As an adapter, it connects amino acids to nucleic acids.

Learn more about Translation initiated here:-brainly.com/question/7169341

#SPJ1

5 0
1 year ago
Other questions:
  • A student conducts an experiment to determine if Ultraviolet (UV) light kills
    14·1 answer
  • #1 The water held back by a dam is an example of which type of energy?
    5·2 answers
  • A ___________________ is a multicellular haploid form and a ____________________ is a multicellular diploid form in a plant that
    11·1 answer
  • The ability of an organism to maintain internal stability is known as?
    5·1 answer
  • PLEASE HELP ME WITH THIS QUESTION
    13·2 answers
  • PLEASE HELP ME! 10 POINTS+BRAINLIEST
    10·1 answer
  • How do you think the rabbit population affected the fox population over the same ten-year period. Explain your reasoning.
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Question #8
    7·1 answer
  • PLEASE SOMEONE HELP ME PLZ!!!!!Photosynthesis is/ is not an example of the Law of Conversation of Mass
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!