1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kryger [21]
2 years ago
11

Replication, Transcription, and Translation Chart

Chemistry
1 answer:
NemiM [27]2 years ago
6 0

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

You might be interested in
1. Water is easily contaminated by both biological and chemical contaminants. Define and give 3 examples of each
tamaranim1 [39]
Are there options like A,B,C,D?

7 0
2 years ago
I really need help please
Greeley [361]

Answer:

I think it's B

hope this helps

5 0
3 years ago
Two species of frog mate in the same pond. One breeds in early summer and one in late summer. This is an example of what kind of
MatroZZZ [7]

Answer:

Pre-zygotic, temporal separation

Explanation:

Reproductive isolation mechanism is of two types:

  • Prezygotic mechanism
  • Postzygotic mechanism

Prezygotic mechanism isolation occurs before fertilization and helpful in preventing formation of fertile offspring.

In frog external fertilization occurs. In the external fertilization, eggs and sperms are released in water and fertilization occur outside the water.

Prezygotic isolating mechanisms may include behavioral isolation, temporal isolation, mechanical isolation, gametic isolation and habitat isolation.

Temporal separation in reproduction is the sexual activity in the same geographical range but in different periods.

Therefore, the given reproductive isolation is pre-zygotic, temporal separation.

4 0
3 years ago
What does it mean to truly love someone?​
Minchanka [31]

Truly loving someone means caring for them in the ways that they need to be cared for, with no strings attached. (That's why they call it unconditional love.)

6 0
1 year ago
A(n)<br> wave carries energy through matter.
denis23 [38]

Answer:

A wave is a disturbance that carries energy from one place to another through matter and space. When we through a stone or a pebble in calm water, then the particles of water moves up and down and this process continues for some time. This implies that there is a disturbance produced in water.

Explanation:

4 0
3 years ago
Other questions:
  • Oxygen is in group 16 of the periodic table. An oxygen ion (O2-) has a charge of -2. Which of the following would be most likely
    8·1 answer
  • What happens to the entropy in the reaction I^2(s) ►I^2(g)?
    10·1 answer
  • Pollution is an example of what kind of environmental problem
    9·1 answer
  • What prefixes is best for measuring large quantities like the mass of a person?
    7·1 answer
  • Consider a series of molecules in which the C atom is bonded to atoms of second-period elements: C-O, C-F, C-N, C-C, and C-B. Pl
    15·1 answer
  • How many molecules are in the substance formula of 2C6H1206 (use coefficients)
    5·1 answer
  • Please help me with this thank you !!
    6·1 answer
  • How many eggs are in 1 mole of eggs?
    6·1 answer
  • A 500 ml aqueous solution of na3po4 was prepared using 82g of the solute. what is the molarity​
    12·1 answer
  • Why do atoms get smaller as you move across a period
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!