1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kryger [21]
3 years ago
11

Replication, Transcription, and Translation Chart

Chemistry
1 answer:
NemiM [27]3 years ago
6 0

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

You might be interested in
What does water offer that attracts human settlement?
Iteru [2.4K]

Answer:

Water is a human necessity. Therefore, it is one of the first things a human settlement would need to have. A community cannot thrive without a water source.

7 0
2 years ago
Read 2 more answers
Given the speed of light as 3.0 × 108 m/s, calculate the wavelength of the electromagnetic radiation whose frequency is 7.5 × 10
arlik [135]
Wavelength= velocity/frequency
wavelength= (3.0 x 10^8m/s) / 7.5 x 10^12 Hz)
you can do the math
I am assuming u that 108 is 10^8 and the 1012 is 10^12
3 0
3 years ago
The one factor that a scientist changes in an experiment is called the
Gala2k [10]

Answer:

It might be responding variable.

8 0
3 years ago
Which substance below exhibits the weakest intermolecular forces?
mestny [16]

Answer:

SO2

Explanation:

6 0
3 years ago
Two litres of an ideal gas at a pressure of 10 atm expands isothermally into a vacuum until its total volume is 10 litres. How m
nlexa [21]

Answer:

The work done and heat absorbed are both -8,1 kJ

Explanation:

The work done in an isobaric process is defined as:

W = -P (Vf - Vi)

Where P is pressure ( 10 atm)

Vf = 10 L

Vi = 2 L

Thus, <em>W = -80 atm×L ≡ -8,1 kJ</em>

This is the work done in expansion of the gas.  As the gas remains at the same temperature, there is no change in internal energy doing that all work was absorbed as heat.

I hope it helps!

4 0
3 years ago
Other questions:
  • What are the major products when glucose is broken down in glycolysis? NAD+ and FAD ATP and NADH ATP, FADH2, and NADH pyruvic ac
    5·2 answers
  • What is the error? NH4OH (aq) + KOH (aq) --&gt; KOH (aq) + NH4OH (aq)
    8·1 answer
  • Why is the nacl extracted with water three times as opposed to only once?
    9·1 answer
  • Chemical reaction is the final part of the sentence<br><br>​
    5·1 answer
  • Where can i buy gallium? Please dont say eBay or Amazon
    10·1 answer
  • What is the ph of an aqueous solution with a hydrogen ion concentration of [h ] = 9.7 × 10–4 m?
    6·1 answer
  • What is the concentration of bromide, in ppm, if 12.41 g MgBr2 is dissolved in 2.55 L water.
    5·1 answer
  • A balloon is filled with 0.250 mole of air at 35°C. If the volume of the balloon is 6.23 liters, what is the absolute pressure o
    15·2 answers
  • 1 point
    7·1 answer
  • What is the mass of helium atom whose atomic weight is 4.003 g/mol?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!