1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kryger [21]
3 years ago
11

Replication, Transcription, and Translation Chart

Chemistry
1 answer:
NemiM [27]3 years ago
6 0

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

You might be interested in
what property of the noble gases most likely prevented the gases from being readily/easily discovered?
Vlad [161]

These gases very rarely react, with others and also noble gases are odourless and colourless.

Explanation:

  • Noble gases will not react with anything so that is the reason why they are known as an inert gas.
  • Noble gases are present in group 18 on the periodic table and following the rule of the octet which is they completed their orbital by s2p6 which is the highest energy level.
  • Most elements are discovering through their reactivity with the other elements, commonly with oxygen. In the case of a noble gas, it is difficult for a scientist to work with the gases which have very less or no chemical property in terms of their reactivity.

7 0
3 years ago
The maximum oxygen uptake is known as the __________.
andrezito [222]
The maximum oxygen uptake is known as the VO2 max.
4 0
3 years ago
Read 2 more answers
Is cis 4-tert-butylcyclohexanol more polar than trans? I recently did a reduction reaction of 4-tert-butylcyclohexanol with sodi
natima [27]

Cis is more polar than trans. Cis would be \_/ and trans is /-/. I am hoping that this answer has satisfied your query about and it will be able to help you, and if you’d like, feel free to ask another question.

7 0
3 years ago
How long does it take for the water to start boiling? At what temperature does the water boil?
Wewaii [24]

Answer:

At sea level, or at zero feet in altitude, the boiling point of water is at 212 °F (100 °C). Once the water has reached this boiling point, the US Center for Disease Control recommends keeping it at a rolling boil for about a minute to make sure it is purified.

6 0
4 years ago
Read 2 more answers
100.0 g of liquid copper (molar mass 63.546 g/mol; melting point 1358 K; density 8.02 g/mL) is placed in a rigid container of vo
gtnhenbr [62]

Answer:

8.912x10^-18

Explanation:

-dn/dt = pANa/2piMRT

100 g = initial copper

Number of moles = 100/63.546

= 1.5736

Mass of copper left = 100-10.0168

= 89.9832

Moles = 89.9832/63.546

= 1.4160

dn = 1.4160-1.5736

= -0.1576

dt = 2 hrs

A = 3.23mm² = 3.23x10^-6

M = 63.546

T = 0.0821

T = 1508k

Na = 6.023x10²³

When we insert all these into the formula above

We get

P = 8.912x10^-18atm

4 0
3 years ago
Other questions:
  • Molecules that have the same chemical formula (same numbers of each atom) but different three-dimensional shapes are called ____
    14·1 answer
  • Which change favors the products in this reversible reaction n2o4(g)+58 kj 2no2 (g)?
    14·2 answers
  • Which four of the following statements about amino acids are true?
    9·1 answer
  • How many grams of water are needed to dissolve 27.8 g of ammonium nitrate?
    12·1 answer
  • Which compound forms a saturated solution at 40 degrees C that contains 46 grams per 100 grams of water?
    8·1 answer
  • The ratio of chlorine to hydrogen chloride in the reaction
    12·1 answer
  • Which substance would have a ph close to 7?
    15·2 answers
  • Anyone know a simple way to describe friction not the definition online, just what you think
    7·2 answers
  • What is the only intermolecular force present in nonpolar compounds?
    11·1 answer
  • Sharing or transfer of electrons from one atom to the other to attain stable octet
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!