1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kryger [21]
3 years ago
11

Replication, Transcription, and Translation Chart

Chemistry
1 answer:
NemiM [27]3 years ago
6 0

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

You might be interested in
“Copper nitrate is a” <br><br> Symbol <br><br> Name <br><br> Chemical formula
umka21 [38]

Answer:

Name!!!!!

Explanation:

7 0
3 years ago
Read 2 more answers
Indigenous rocks form by the cooling and hardening of melted rock.* True False​
salantis [7]

Answer: True

Explanation: They are formed by the cooling and hardening of molten magma

3 0
3 years ago
How many quarters fit in a 1.75 liter bottle?
WARRIOR [948]
1.85 quarts can fit into a 1.75 liter bottle
8 0
3 years ago
Read 2 more answers
Metallic pan is provided with a wooden plastic handle give reason​
AlladinOne [14]

The metallic pan iis most likely going to be used on a stove.

The stove is heating something, and the conductive metallic pan will, well, conduct that heat throughout the entire body of the pan. Doing this will spread the heat to the handle, burning your hands.

Both wood and plastic are insulators, and they do not conduct heat or electricity. They will insulate your hands and protect them from the heat.

5 0
3 years ago
A. Match the term with its definition. (1 point)
Assoli18 [71]

Taking into account the definition of wavelength, frecuency and propagation speed:

  • Frequency: The number of waves passing a point in 1 second.
  • Wavelength: The distance between two adjacent wave peaks.
  • Velocity:  The direction and speed at which a wave is traveling.

The equation that illustrates the relationship between wave velocity, frequency, and wavelength is v = f×λ.

<h3>Wavelength</h3>

Wavelength is the minimum distance between two successive points on the wave that are in the same state of vibration. It is expressed in units of length (m).

<h3>Frequency</h3>

On the other side, frequency is the number of vibrations that occur in a unit of time. Its unit is s⁻¹ or hertz (Hz).

<h3>Propagation speed or velocity</h3>

Finally, the propagation speed is the speed with which the wave propagates in the medium, that is, it is the magnitude that measures the speed at which the wave disturbance propagates along its displacement.

The propagation speed relate the wavelength (λ) and the frequency (f) inversely proportional using the following equation:

v = f×λ

All electromagnetic waves propagate in a vacuum at a constant speed of 2,998 x 10⁸ m / s, the speed of light.

Therefore, the previous expression establishes an inversely proportional relationship between the frequency and the wavelength: The higher the frequency, the lower the wavelength and when the frequency is lower, the greater the wavelength.

<h3>Summary</h3>

In summary, the definition of frequency, wavelength and velocity are:

  • Frequency: The number of waves passing a point in 1 second.
  • Wavelength: The distance between two adjacent wave peaks.
  • Velocity:  The direction and speed at which a wave is traveling.

Finally, the equation that illustrates the relationship between wave velocity, frequency, and wavelength is v = f×λ.

Learn more about wavelength, frecuency and propagation speed:

<u>brainly.com/question/2232652?referrer=searchResults</u>

<u>brainly.com/question/7321084?referrer=searchResults</u>

<u>brainly.com/question/14946166?referrer=searchResults</u>

#SPJ1

3 0
2 years ago
Other questions:
  • Rank the following solutions from least polar to most polar. Rank on a scale of 1-4: 1 being the least polar and 4 being the mos
    14·1 answer
  • Argon has a mass of 2.82 grams, what is Argon's volume at STP?*
    15·1 answer
  • What mass of nitrogen is required to react with 16 grams of oxygen?
    6·1 answer
  • A student is asked to model gas pressure using two walls and a ball connected to a string, as shown. The ball represents a gas p
    13·1 answer
  • If we view a 1st quarter moon tonight , how many weeks will pass before we view the next new moon?
    12·2 answers
  • How many molecules of carbon monoxide gas can be produced from 395 grams of oxygen gas ?
    6·1 answer
  • The basic principle in balancing a chemical equation is to ______.
    14·1 answer
  • An adaptation allows an organism to _________________.
    6·1 answer
  • an object with a mass of 7.6 G raises the level of water in a graduated cylinder from 25.1 ml to 30.8 ml what is the density of
    5·1 answer
  • What does it mean if two objects are in thermal equilibrium?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!