1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maria [59]
3 years ago
8

Do you believe that all of our actions can be attributed to the nervous system? Does your memory of an event trigger your respon

ses? Why or why not?
Biology
1 answer:
svet-max [94.6K]3 years ago
5 0

Answer:

The nervous system is made up of all the nerve cells in your body. It is through the nervous system that we communicate with the outside world and, at the same time, many mechanisms inside our body are controlled. The nervous system takes in information through our senses, processes the information and triggers reactions, such as making your muscles move or causing you to feel pain. For example, if you touch a hot plate, you reflexively pull back your hand and your nerves simultaneously send pain signals to your brain. Metabolic processes are also controlled by the nervous system.

Explanation:

You might be interested in
8. DNA is copied into mRNA during the process of ________________.
MAXImum [283]

question 8

DNA is copied into mRNA  during  the process of  <u>Transcription</u>

  • <u>  </u>Transcription  is the process by which  information  in the strand of DNA  is copied into   new  molecule  of  messenger  mRNA.
  • The mRNA   formed is a complimentary  to  DNA  strand   whereby replace   of  C with   G,  and  A  with U and T with  A.

 Question 9

Translation  occurs  in  the  ribosome ,  the  organelle  responsible  for  building  proteins.

  •    Ribosome   are responsible for protein synthesis.
  •  They receive  messenger RNA sent  from  the nucleus  and build protein.
  • translation    has  three  steps that is
  1.   initiation -  ribosome assemble  around the target  mRNA.
  2.  elongation- The tRNA transfer  amino acid  to  tRNA  corresponding to  the next codon.
  3. Three  phases of translation initiation  polymerase  bind  to DNA  strand  and move  along until the small ribosomal  subunit  binds to  DNA.
6 0
3 years ago
Is mitosis involved with two sets of nuclear divisions
Naya [18.7K]

Answer:

NO. Mitosis involves one set of nuclear division and results in two nuclei that are exactly the same as the original. On the other hand, meiosis involves two sets of nuclear divisions.

Explanation:

Mitosis is a type of cell division normally occurring at the sites of growth and development of new tissues and also at sites of repair. It also occurs during asexual reproduction of organisms. Each mitotic cell division is a process that follows distinct phases.

Each mitotic division results in the formation of two daughter cells which are genetically identical to the parent cell, that is they have the same number and type of chromosomes as the parent cell.

During telophase, a nucleolus develops in the nucleus of each daughter cell. The cytoplasm divides in the process called cytokinesis. An invagination develops and finally splits the cell into two daughter cell each with its own nucleus and cytoplasm.

5 0
3 years ago
Which one of the following human activities is the greatest threat to biodiversity?
lesya [120]

Answer:

Overharvesting

Explanation:

Too much harvest and planting causes the soil to wear down and be less useful.

4 0
2 years ago
Read 2 more answers
What codes for proteins?
aev [14]

I think it's A. DNA

Hope this helps

:>

7 0
3 years ago
Which artery serves the distal part of the large intestine via its left colic, sigmoidal, and superior rectal branches?.
Elan Coil [88]
Inferior mesenteric artery
The part of the colon located distal to the left colic flexure is derived from the hindgut is supplied by the inferior mesenteric artery. The distal part (lower third of the rectum) is supplied by the internal iliac artery. The ileocolic artery supplying the cecum is a branch of the superior mesenteric artery.
8 0
2 years ago
Other questions:
  • Nerve cells send electrical impulses along the _____. when these impulses reach the end of the neuron, they cause a release of n
    9·2 answers
  • Give three reasons how ionic and covalent bonds are different
    9·2 answers
  • Which of the following terms means that there are more large businesses and factories and more people work jobs instead of subsi
    13·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • How are photosynthesis and cellular respiration similar?
    8·1 answer
  • Need help on this question ?
    8·1 answer
  • I'll give brainliest if you answer the question
    8·2 answers
  • What is a gene? Choose the definition that best matches the term Gene.
    13·2 answers
  • Can some one answer this questions please ​
    13·1 answer
  • Who was the first prime minister of USA​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!