1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elanso [62]
2 years ago
7

How many 250 mg tablets of metronidazole are needed to make 150 mL of suspension containing

Chemistry
1 answer:
Neko [114]2 years ago
7 0

Answer:

How many 250 mg tablets of metronidazole are needed to make 150 mL of suspension containing

100 mg/mL?

a. 25

b. 30

c.50

d. 60

Explanation:

<em>if </em><em> </em><em>mali </em><em>po </em><em>I'm</em><em> </em><em>so </em><em>sorry</em>

You might be interested in
HELP PLZ
Vinvika [58]

Answer:

1). 19.9

2). 0

8 0
3 years ago
Read the reaction and the statement. H2(g) + I2(g) ⇌ 2HI(g) The concentration of H2, I2 and HI are measured as 0.04 M, 0.08 M an
hjlf

Answer:

45467777777777yt3457942

4 0
2 years ago
The rules of engagement (roe) working group is often used to _____. (select all that apply.)
Gnesinka [82]

Answer:

proactively develop ROE as well as responding to requests for additional ROE measures

Explanation:

The rules of engagement (roe) working group is a group who's main job is to  proactively develop ROE as well as responding to requests for additional ROE measures. Rules of Engagement are a set or rules or directives for military soldiers that define the circumstances, conditions, degree, and manner in which the use of force can be used.

3 0
3 years ago
Which molecule has a nonpolar covalent bond?
kondaur [170]
Nonpolar covalent bonds are chemical bonds where two atoms share a pair of electrons with each other and the electronegativities of the two atoms are equal. An example is methane. It has four carbon-hydrogen single covalent bonds. These bonds are nonpolar because the electrons are shared equally.
8 0
3 years ago
Read 2 more answers
1500 millimeters to km
gizmo_the_mogwai [7]
0.0015 kilometers is for sure the answer!
4 0
3 years ago
Other questions:
  • What is the product when magnesium reacts with sulfuric acid? mg(s) h2so4(aq) →what is the product when magnesium reacts with su
    14·2 answers
  • What is the formula of Potassium Bicarbonate?​
    6·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The diagram below shows students set-up for the preparation and collection of oxygen gas
    12·1 answer
  • Which of the following is best described by the term macroscopic?
    10·1 answer
  • Cameron is a doctor treating a cancer patient, Billy is an archeologist dating a vase, and Isabelle is a geologist dating a laye
    13·2 answers
  • What are the number of protons, neutrons, and electrons in 19 F<br><br> 9?
    7·1 answer
  • hey yall .......................................................................................................................
    10·2 answers
  • What is the phase of water at 1.0 atm and 50°C?
    12·1 answer
  • Aqua regia, a mixture of concentrated HNO₃ and HCl, was developed by alchemists as a means to "dissolve" gold. The process is a
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!