1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elanso [62]
3 years ago
9

A scientific explanation for a natural occurrence is called

Biology
2 answers:
artcher [175]3 years ago
4 0
Pretty sure it's a hypothesis
allochka39001 [22]3 years ago
3 0

Answer:

The correct answer is hypothesis.

Explanation:

A proposed illustration of a phenomenon is considered as a hypothesis. A scientific method requires one to test the hypothesis in order for a hypothesis to become a scientific hypothesis. Scientific theory and a scientific hypothesis are not the same things. A provisionally accepted hypothesis that has been suggested for further research is termed as a working hypothesis.

You might be interested in
he eastern coral snake and texas coral snake look almost identical and are often mistaken, but they are actually different speci
Degger [83]

Answer:

They will have sterile offspring.

Explanation:

7 0
3 years ago
Read 2 more answers
What happens when human body temperature rises during exercise?
In-s [12.5K]
There heart began to beat faster and their body produce more sweat and there blood is following faet
7 0
3 years ago
What other structures of the cytoskeleton would show the same pattern of microtubules as a flagellum
pashok25 [27]

Answer:

<u>Cilia</u>

Explanation:

Cilia and flagellum are made up of microtubules.

Cytoskeletal filaments are structures which allow movement. In cilia and flagella, the cytoskeletal filaments are present in the form of microtubules and the primary work of these structures is to facilitate in movement.

Cilia is also present in mammals to facilitate the movement of fluids in cells.

Structurally, there is no difference between cilia and flagella. The only difference between cilia and flagella is in their lengths.

5 0
2 years ago
The adrenal glands produce _________, a class of chemicals that includes the neurotransmitters dopamine, norepinephrine, and epi
statuscvo [17]
The adrenal glands produce hormones...
8 0
3 years ago
This orgennelle is where proteins are made
valkas [14]
Ribosomes are the organelles of the cell which are involved in protein-synthesis (I. e. process of making proteins)
4 0
2 years ago
Other questions:
  • Advertising objectives can be classified based on three primary purposes. what are the three​ purposes?
    11·1 answer
  • True or false most proteins have blocked amino and carboxyl terminals.
    6·1 answer
  • Can you guys help me pls
    14·1 answer
  • Meiosis produces four new cells with ______ the chromosomes as the parent cell. two-thirds one-half one-quarter one-third
    9·1 answer
  • The surface area of the small intestine is comparable to...
    11·1 answer
  • CU.
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Describe an example of an endothermic and exothermic reaction. For each of your reactions, identify whether it is a physical or
    11·2 answers
  • Define the photosynthesis?​
    13·2 answers
  • What are some(4) similarities between dark field microscopes and bright field microscopes?​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!