1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nat2105 [25]
2 years ago
10

What do the letters on the inside of a Punnett square represent?

Biology
1 answer:
bekas [8.4K]2 years ago
5 0
The Parents genes are what’s represented
You might be interested in
Suppose that after the cell below undergoes meiosis i and meiosis ii, the result is one gamete with two chromosomes, two gametes
lianna [129]
<span>The correct answer for the question is Non-disjunction. Non-disjunction occurs in cell division when chromosomes do not divide properly. It can occur during mitosis, meiosis I and meiosis II. In mitosis it occurs when sister chromatids fails to separate in Anaphase. The result is that one cell receives both chromatids, while the other receives neither. Each daughter cell then has an abnormal number of chromosomes when mitosis is complete; one cell has an extra chromosome, while the other is missing one. In anaphase of meiosis I, it happens when a pair of homologous chromosomes does not separate. In meiosis II, it happens when a pair of sister chromatids fails to separate properly during anaphase of meiosis II, one daughter cell will have an extra chromosome and one daughter cell will be missing a chromosome.</span>
7 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
How does carbon dioxide affect the ecosystem
FrozenT [24]

As a greenhouse gas that absorbs heat, CO2 raises the temperature of the atmosphere. We refer to this as global warming. The glaciers will melt more quickly as the world's temperature rises, raising sea levels and bringing on disaster. More power is consumed for air conditioning as the temperature rises, which further raises the air's CO2 level.

Since coal is the primary fuel utilized in the creation of power. This creates a vicious cycle.

3 0
2 years ago
What happens when two species occupy the exact same niche
Papessa [141]
There will always be one stronger species that take over, which is what evolution has taught us.  

I believe the answer would be D. <span>Only one will survive. 

Have a good day!</span>
4 0
3 years ago
Read 2 more answers
Digested starches, sugars, and proteins are absorbed by the?
bekas [8.4K]
They are absorbed by the amylase.

5 0
3 years ago
Other questions:
  • Which would be a result of increased deforestation?
    13·2 answers
  • Which important property of DNA did Friedrich Miescher discover?
    15·2 answers
  • Where simple sugars are broken down into carbon dioxide, water vapor and atp ogranelle?
    5·1 answer
  • 5. A ________ is wind-powered movement of ocean water over great distances.
    10·1 answer
  • Which cells produce antibodies? a)Helper T cells b)T Lymphocytes c)B Lymphocytes d)Cytotoxic T Cells
    12·2 answers
  • Invasive species can impact ecosystems by...
    8·2 answers
  • Energy Graph
    14·1 answer
  • In marsupials, X inactivation occurs exclusively to paternally derived chromosomes. Which genes will
    10·1 answer
  • Match each of the five levels of organization to their proper definition.
    7·1 answer
  • What did one volcano say to the other?=<br> What animal is always at a baseball game?=
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!