What do the letters on the inside of a Punnett square represent?

What are 5 adaptations of the rubber tree in the Amazon rainforest

topjm [15]

1. The tree can grow to over 100 feet tall
2. Reproduction happens when the fruit of the tree ripen and burst open, leaving seeds scatteredin a 100 foot
3. The leaves of the Rubber Tree are glossy, oval shaped and dark green. They can grow to be 14 inches
4. It is a quickly growing tree, as are most trees in the (related to areas near the Equator/hot and humid) rainforest, it can grow 24 inches
5. The Rubber tree grows best in bright sunlight or filtered sun and although it is best suited for the wet and hot climate

6 0

3 years ago

Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque

Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0

3 years ago

What role do the mountains play in creating biome?

ASHA 777 [7]

Mountains determine wind flow, as well as serving as a cloud break. Depending on which side of the mountain you’re on, you will either have a mostly dry, dead region. Or a moist, fertile region.

4 0

3 years ago

Introns must be removed prior to translation of the mRNA. In addition, eukaryotic transcripts (mRNA) have to undergo two more st

Ivan

Eukaryotic transcripts (mRNA) have to undergo capping and splicing before it can be translated.

<h3>RNA processing:</h3>

1. An RNA transcript is first produced in a eukaryotic cell as a pre-mRNA, which needs to be converted into a messenger RNA (mRNA).

2. The RNA transcript is given a 5' cap at the start and a 3' poly-A tail at the end.

3. The process of splicing involves cutting out some RNA transcript segments (introns), then joining the remaining segments (exons) back together.

4. Some genes have the ability to alternate splices, which produces various mature mRNA molecules from the same beginning transcript.

The introns not only do not contain the information necessary to construct a protein, but they also need to be cut off in order for the mRNA to create a protein with the correct sequence. An mRNA with extra "junk" in it will be created if the spliceosome fails to remove an intron, and the translation process will result in the production of the incorrect protein.

Learn more about RNA transcript here:

brainly.com/question/13834206

#SPJ4

6 0

2 years ago

Ecosystem services include processes that increase the quality of the abiotic environment. Which of the following processes woul

slega [8]

Answer:

Option D, only II, III, and IV

Explanation:

Complete Question

Ecosystem services include processes that increase the quality of the abiotic environment. Which of the following processes would fall under this category?

I) Keystone predators have a marked effect on species diversity.

II) Green plants produce the oxygen we breathe.

III) The presence of land plants builds soil.

IV) The presence of diverse wetlands helps in flood control.

A) only II and IV

B) only I and III

C) only I, II, and IV

D) only II, III, and IV

Solution -

The services of ecosystem has been classified into four groups

a) Provisioning – Where essential abiotic and biotic substance are produces such as production of food and water, reproducing offspring etc.

b) Regulating – the ecosystems is controlled through environmental factors such as control of climate and disease

c) Supporting – Ecosystem support the activities that are essential for survival. Primarily includes all nutrient cycles, oxygen generation etc.

d) Cultural – Provide aesthetic view and recreational benefits

Option II co mes under supporting service of ecosystem

Option III co mes under Provisioning service of ecosystem

Option IV co mes under Regulating service of ecosystem

Hence, option D is correct

5 0

3 years ago