1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka2103 [35]
3 years ago
15

Select the correct answer. What is a scientific theory?

Biology
1 answer:
ahrayia [7]3 years ago
7 0

Answer:

Scientific theory definition, a coherent group of propositions formulated to explain a group of facts or phenomena in the natural world and repeatedly confirmed through experiment or observation: the scientific theory of evolution.

Explanation:

You might be interested in
The human activities in two locations are described below: Location A: Oil drilled from several mines Location B: Unregulated ha
Aleks04 [339]

There will be mass migration of animals from Location B because of habitat loss.

7 0
3 years ago
Read 2 more answers
Which functional group is involved in energy release in all living cells? A. Amino group B. Carboxylic group C. Phosphate group
inessss [21]
Imma go for B. Carboxylic group
4 0
3 years ago
Which terms are used for gametes that are needed for reproduction in vertebrate animals?
rjkz [21]
The answer is A.Sperm and eggs
5 0
3 years ago
If a DNA sequence has 14 nucleotides what is the maximum number of amino acids that can be coded
navik [9.2K]
The nucleotide triplet that encodes an amino acid is called a codon. Each group of three nucleotides encodes one amino acid. Since there are 64 combinations of 4 nucleotides taken three at a time and only 20 amino acids, the code is degenerate (more than one codon per amino acid, in most cases).
3 0
2 years ago
PLEASE HELP ASAP!!! WILL GET BRAINLIEST! And lots of points.
Len [333]

Answer:chimaeras

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which substances are most commonly used as building blocks in the synthesis(making) of some lipids
    13·2 answers
  • Which of the following suggests that humans have reached our carrying capacity? Humans are unable to increase food production to
    8·1 answer
  • The chemical energy stored in ATP during photosynthesis is released during the dark phase to _____.
    12·2 answers
  • What is the measurement of a triangle?
    12·1 answer
  • PLEASE HURRY IM TIMED According to the diagram of the water cycle, what happens to the water in the oceans before it becomes wat
    14·1 answer
  • Which layers of the atmosphere does the temperature decrease the higher you go?
    12·2 answers
  • Which of the following best describes daily temperatures in deserts?a. hot during the day and cold at night b. hot during the da
    14·2 answers
  • Help is appreciated
    5·1 answer
  • The moon_around the earth.​
    10·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!