1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lana71 [14]
3 years ago
14

What is the scientific name for dog

Biology
2 answers:
slamgirl [31]3 years ago
5 0
Canis lupus familiaris
lina2011 [118]3 years ago
3 0
The scientific name for dog is canine
You might be interested in
Which organisms utilize a one-way air flow through their lungs to maximize air flow efficiency and
Stella [2.4K]
Birds

Birds are organisms which utilize a one-way air flow through their lungs to maximize air flow efficiency and <span>oxygen consumption

</span>The process of respiration is essential in the oxygen/carbon dioxide cycle. Respiration removes OXYGEN <span>from the atmosphere and produces and releases </span>CARBON DIOXIDE to the atmosphere.answer is letter D.

<span>Respiration driven by a mechanical series called inhalation and exhalation. We inhale or breathe in oxygen and exhale or breathe out carbon dioxide. </span>
8 0
3 years ago
Which does the one-leg stand of the field sobriety test group assess​
ad-work [718]

The one-leg stand test is something the cops do to people when they pull them over depending on the way that person was driving to tell whether you were under the influence of alcohol or drugs.

(Speaking from experience)#dontgetcaught

8 0
3 years ago
Cyclin-dependent kinases (Cdks) are enzymes involved with the control of mitosis; Drs. Lee Hartwell and Paul Nurse won the Nobel
Deffense [45]

Answer:

Option C

Explanation:

Dr. Leland Hartwell used baker’s yeast, <em>Saccharomyces cerevisiae</em>, as a model system, which was a highly suitable model for cell cycle studies. He introduced the concept of Checkpoints where he said cells are arrested if damaged so that the cells repair system can work to correct such damages. Dr. Paul Nurse used a different type of yeast, <em>Schizosaccharomyces pombe</em>, a type of yeast distantly related to the baker's yeast as a model organism.

7 0
3 years ago
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t
wel

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

<u>DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. </u>This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

<u>Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis.</u> The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

8 0
3 years ago
This kingfisher's beak can be measured as about 4.2 cm
erik [133]

Answer:

Common Kingfishers measure 17 – 19 centimetres in length, weigh between 34 – 46 grams and have a wingspan of 25 centimetres. Their beak is around 4 centimetres long and pointed. Kingfishers have short, orange coloured legs. Kingfishers are very brightly coloured. The colour of their wings is a blue/green colour and their upperparts, rump and tail are a bright blue colour. Their underparts are bright orange and they have a small, white bib underneath their beaks, on their throats.

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Earthquakes are possible because the tectonic plates around the earth shift and move, converging, diverging, or transforming whe
    6·2 answers
  • Meiosis results in half the number of chromosomes as the original. True False
    12·2 answers
  • This is a method used by some animals, bats for example, that uses sound waves to help locate prey and other objects in the dark
    14·1 answer
  • How does meiosis introduce genetic variation into offspring?
    6·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • which statement best distinguished the light dependent (L-D) reactions from the light-independent (L-IND) reactions?
    5·1 answer
  • One of the roles of blood is to transport nutrients around the body and deliver molecules such as sugars and lipids to cells. A
    8·1 answer
  • How are starch and glycogen related
    13·2 answers
  • Why might you expect fluorocitrate to have an inhibitory effect on one or more of the TCA cycle enzymes if incubated with the pu
    12·1 answer
  • The
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!