1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Slav-nsk [51]
3 years ago
15

Can you guys please help me? I really need to finish this asap. Thanksssss <3

Biology
1 answer:
Ksivusya [100]3 years ago
8 0

Answer:

b

Explanation:

their cell walls contain chitin unlike plant cell walls which contain cell walls

You might be interested in
Even when asymptomatic, _______ can still be actively multiplying and killing cells in the immune system that help fight pathoge
podryga [215]

Even when asymptomatic, the virus can still be actively multiplying and killing cells in the immune system that help fight pathogens. This is further explained below.

<h3>What is a virus?</h3>

Generally, the virus is simply defined as a virus consisting of a core of genetic information, either DNA or RNA, wrapped by a capsid, which is a protective covering formed of protein.

In conclusion,  It is possible for the virus to be actively reproducing and destroying immune cells even in the absence of any outward symptoms.

Read more about the virus

brainly.com/question/25859411

#SPJ1

3 0
2 years ago
How many years does a snake live and how many times does it change its skin without pictures please and without links​
irina [24]

Answer:

9 years

Explanation:

Boa constrictor: 30 years

Boa constrictors are native to North, Central, and South America, mainly dwelling in rainforests. The lifespan for the large, heavy-bodied snake averages about 20 years in the wild, but living in captivity can increase that by 10 to 15 years.

8 0
3 years ago
Read 2 more answers
During which phase mitosis do the nuclear membrane nucleolus and dissolve
Lisa [10]

Prophase is the right answer

5 0
3 years ago
Bagaimana adaptasi tubuh manusia terhadap kadar oksigen yang rendah dipegunungan
never [62]
<span>Persentase oksigen di udara di dua mil (3,2 km.) Pada dasarnya sama dengan di permukaan laut (21%). Namun, tekanan udara adalah 30% lebih rendah pada ketinggian yang lebih tinggi karena fakta bahwa atmosfer kurang padat - yaitu, molekul udara yang jauh apart.When kita menghirup udara di permukaan laut, tekanan atmosfer sekitar 14,7 pounds per square inch (1,04 kg. per cm.2)


(i speak indoinision to)
</span>
7 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • In a short paragraph, identify five factors that are contributing to the Europeanization of culture and identity across the cont
    10·2 answers
  • the blood cells that contain a red pigment called hemoglobin for bringing oxygen to the cells of the body are the
    9·1 answer
  • In cattle, red coat color is co-dominant to white coat color. What could be the result of a cross between a RR male and a WW fem
    12·1 answer
  • Identify the cavity that develops entirely from the mesoderm.
    12·1 answer
  • How can we help maintain healthy bay,estuary, and coastal ecosystem
    6·1 answer
  • In which way are euglena and a volvox diferent​
    12·1 answer
  • Your teacher gives you this model of transcription. Choose the statement that best describes the role of DNA in transcription.
    10·1 answer
  • Fill the blanks plz
    8·2 answers
  • If Hh represents two alleles, what percentage of gametes produced will have the H allele?
    12·1 answer
  • What is meant by the term "UV"? In your answer, please explain how it
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!