Answer:
An allele is one of two, or more, forms of a given gene variant. For example, the ABO blood grouping is controlled by the ABO gene, which has six common alleles. Nearly every living human's phenotype for the ABO gene is some combination of just these six alleles.
Explanation:
Plz give me brainliest worked hard.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
The Mendelian principles of inheritance ARE APPLIED IN HUMANS. Both plants and animalls posseses two alleles (forms) of each gene, and are inherited in Mendelian ways. Some genetic diseases are Mendelian diseases and are inherited according to Mendel laws, those are the diseases caused BY A SINGLE GENE. However, there are multigenic diseases (that involves more than one gene), multifactorial diseases (which involves several genes and environmental factors), and chromosomic diseases (like 21 trisomy) and all of these does not follow the Mendel laws.
Explanation:
The correct answer is B: Time-consuming process of listing endangered species.
It is an example of a failed attempt to reintroduce clapper rails in California.
The California clapper rail is noted as an endangered species.
Endangered species are plants and animals that are in close danger of being extinct.
Hello.There are 5 levels of cell organization recognized by biologists The 5 levels consist of :
1) cells
2) tissues
3) organs
4) organ system
5) organism
Feel free to ask me more questions on my profile. I am more than happy to help. Don't forget Brainliest! :)
