1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandr82 [10.1K]
3 years ago
10

Use the map to answer the following question:

Biology
1 answer:
Cerrena [4.2K]3 years ago
5 0

Answer:

Hello, what is the questiom=n?

Explanation:

You might be interested in
A higher concentration of molecules causes a faster chemical reaction. This is known as _____.
AnnyKZ [126]
Chemical equilibrium, because all reaction speed in an equilibrium would shift towards the side with the least concentration of molecules.
4 0
3 years ago
Please answer ;-;
miskamm [114]

Answer:

<h3><u>Required Answer</u><u>:</u><u>-</u></h3>
  • To find velocity of a object we need 3 factors
  1. Magnitude
  2. speed
  3. Distance
  • Hence Here both option A and C are correct

3 0
3 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
One of your lab partners has followed the recommended procedure of running Gram-positive and Gram-negative control organisms on
kow [346]

Answer:

The correct answer is "I would suggest her to change the Gram positive control from Bacillus subtilis to other bacteria".

Explanation:

Bacillus subtilis, and the species from the genre Bacillus, are known for losing the crystal violet coloration during Gram testing. It is likely that B. subtilis might look pink under the procedure for this reason. I would suggest to change her Gram positive control from B. subtilis to other bacteria. For instance, she could try with Staphylococcus aureus, a widely used bacteria as Gram positive control.

5 0
3 years ago
PLEASE HELP?!! WILL MARK BRAINLY
saw5 [17]

Answer:

You just posted his one? Credit to: Vermont Legislative Research Shop

Explanation:

If you need extra resources: Lawn and garden chemicals, such as fertilizers enter the groundwater in two ways. In the first method, the chemicals can enter the groundwater by rainwater into a stream as runoff. This is especially problematic in urban environments where hard-surfaced roads allow rainwater to move over them without benefit of soil acting as a filter (Rosen and White, 1999). The water in streams replenishes groundwater, so the chemicals are absorbed into the groundwater as well. The second method of contamination is through leaching, which is the downward movement of a substance through the soil. The fertilizer may also dissolve into the surface water, which recharges the groundwater (Virginia Cooperative Extension, 1996).  Nitrate is highly soluble and readily leaches into groundwater. Water with over 10 parts per million nitrate-nitrogen can cause methemoglobinemia, an inability to use oxygen in infants. The nutrient phosphorus harms clear, free water by creating algal blooms. This process, known as eutrophication, turns the water green, clouds the water, causes odor problems, and depletes the oxygen for fish and other species, effectively suffocating them (Lake Champlain Basin, 1998).  To ensure that the groundwater does not get so contaminated as to be unhealthy, in 1986 the Department of Food and Markets implemented the Pesticide Monitoring Program. The goal of this program is to test wells in agricultural areas to help farmers learn about practices that prevent pesticides from leaching into the groundwater, and to conserve the nutrients in fertilizers and manure in the soil. This program is funded by fees taken from companies that sell pesticides and fertilizers in Vermont (Vermont Department of Agriculture, Food and Markets, 1998).

7 0
3 years ago
Other questions:
  • a patient has diabetes a disease that causes high blood cuter levels which macromolecule will a dietician monitor the most close
    13·2 answers
  • PLEASE HELP biology question
    8·1 answer
  • Question 5 Multiple Choice Worth 2 points)
    15·1 answer
  • Select the correct answer from the drop-down menu.
    12·1 answer
  • Describe what happens to chromosomes before mitosis.
    11·2 answers
  • The body system is responsible for creating new life.
    10·1 answer
  • Which type of reaction is represented by the following equation?
    8·2 answers
  • List two ways that she could have become infected with the virus​
    8·2 answers
  • Will give brainliest
    12·1 answer
  • Why an apple and a glass of milk can give you more nutrition as compared to the milk shake Prepared from apple and milk. Justify
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!