1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elina [12.6K]
3 years ago
12

Take any two words and connect them to form a sentence about photosynthesis.

Biology
2 answers:
givi [52]3 years ago
7 0

Answer:

Solution:

plant's takes <u>carbon</u><u> </u><u>dioxide</u><u> </u> ,<u>water</u><u> </u><u>,</u><u>sunlight</u><u>,</u><u>and</u><u> </u><u>minerals</u><u> </u>and produce <u>glucose</u><u> </u>and excrete out <u>oxygen</u><u>:</u>

S_A_V [24]3 years ago
4 0
Take any two words and connect them to form a sentence about photosynthesis.
PRODUCT and REACTANT go together because any reactants in a chemical equation will result in a product of the reactants.
You might be interested in
Which of the following correctly compares how plant and animal cells differ?<br> (4 points)
a_sh-v [17]

Answer:Which of the following correctly compares how plant and animal cells differ? Plant cells have a cell membrane and cell walls for support, but animal cells do not have cell walls. ... Animal cells have DNA in their nuclei and mitochondria, while plant cells have it in their nuclei, mitochondria, and chloroplasts.

Explanation:

HOPE THIS HELP YU  ALOT REMDEMDER ADD ME ON BRAINLY

7 0
3 years ago
In the models above, you labelled a cell wall and flagellum only on the bacteria cell—not the animal
Zepler [3.9K]
No. animal cells are not as mobile as bacteria, which means they don’t need a flagellum. Animal cells do not need a cell wall- as the cell wall is primarily used to maintain structure, which is needed in photosynthetic plants. please give this brainliest!
3 0
3 years ago
Which is a possible reason for the transition of algae from unicellularity to multicellularity? A) the transition to multicellul
galben [10]

A possible reason for the transition of algae from unicellularity to multicellularity would be the evolution of multicellularity allowed algae to develop traits that keep them close to the land and thus a source of nutrients. The correct answer between all the choices given is the last choice. I am hoping that this answer has satisfied your query and it will be able to help you in your endeavor, and if you would like, feel free to ask another question.

6 0
3 years ago
1. Michelle's classmates all decided to measure their height, and found the mean height to be 5'7". Tony's classmates all decide
Soloha48 [4]

It is not possible to determine this from this info. Thus, option "B" is correct.

<h3>What is standard error of mean?</h3>

The standard error of mean is computed by dividing the standard deviation to the square root of sample size. It can be represented as

The standard deviation of the sampling distribution is known as the standard error of mean because it measures the accuracy of sample mean as compared to population mean.

Thus, option "B" is correct.

To learn more about standard error of mean click here:

brainly.com/question/23781364

#SPJ1

3 0
3 years ago
How many parts does the plant cell has
Lilit [14]
I’m thinking 8..
Hope this helps, if you haven’t gotten on google yet haha
4 0
4 years ago
Other questions:
  • Rickettsia are obligate intracellular parasites that are transmitted by arthropods. In which of the following places would you m
    11·1 answer
  • Why does the female worm lay so many eggs
    12·1 answer
  • based on the fluid mosaic model of the cell membrane, which type of molecule can move passively across the membrane, without the
    6·1 answer
  • What is the name of the boundary where the lithosphereic plate descends beneath an overrriding plate
    8·1 answer
  • What happens when a chlorine atom gains an electron in its outer energy shell?
    12·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • Which of these provides an example of molecules moving by facilitated diffusion?
    11·1 answer
  • [Giving brain+follow+ty+likes!]
    11·1 answer
  • The __________ air mass is the most important contributor to lake-effect snow.
    5·1 answer
  • What statement correctly describes the relationship among endocrine glands, target cells, water-soluble hormones, and lipid-solu
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!