1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vladimir2022 [97]
3 years ago
12

Someone help me please I’ll make brainlist!! Quick fast

Biology
1 answer:
yulyashka [42]3 years ago
4 0

Answer:

I think this is 2 because there would have been bigger predators in the ocean vs. a lake

You might be interested in
Dinosaurs survived for at least 700,000 years after meteorite collision Discuss how the research in this article shows how new t
Novay_Z [31]

New research shows how technology and experimental methods in science can always help and be of help when trying to find out the fine details and see how a theory should be updated and what is needed to be corrected in a certain hypothesis or theory. 


Dinosaurs they are termed as a diverse group of reptiles. They first appeared in the time of triassic.

After triassic and jurassic extinction event, dinosaurs became terrestrial vertebrates.




8 0
3 years ago
Read 2 more answers
Irish Setters are type of dog. In Irish Setters, the allele for red coat color (R) is dominant over the allele for brown coat
GREYUIT [131]

Answer:

2 Rr, 2 rr. (2:2 ratio)

Explanation:

The offspring will be Rr Rr and rr rr.

Since the red coated parent is heterozygous the recessive gene will have more of a chance to show when bred with the recessive brown Irish Setter.

<em>Hope this is correct. Have a great day.</em>

7 0
2 years ago
What causes waves to bend?
N76 [4]
Gravity is one reason but also it depends in the speed, if the wave is fast, it will go higher and then bend.   hope i helped :D
6 0
3 years ago
Where is the urine stored before micturition from the body?
GaryK [48]
Urine is stored in the Bladder before it leaves the body.
8 0
3 years ago
Why can water pass through the cell membrane?
Alla [95]
Water can pass throught the cell membrane because, the cell membrane has little holes in the membrane allowing water to go through

8 0
3 years ago
Other questions:
  • What is a condition in which nerves are entrapped between the metatarsal heads producing swelling with distal, radiating pain?
    15·1 answer
  • Farah is learning that some statements on food labels are more reliable than others. "low fat" is which type of claim?
    6·1 answer
  • HIV kills or damages the body's ________.. A. Liver cells . B. Immune system cells . C. Prostate cells . D. All of the above
    15·1 answer
  • Foods that allow microorganisms to grow are called parasites. TRUE or FALSE
    10·2 answers
  • Which of the following is land devoted to forest production and maintenance?​
    6·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which statement regarding these methods of reproduction is correct?
    12·1 answer
  • Which cell molecules would be used to make viral proteins?
    10·1 answer
  • Blood
    12·2 answers
  • Failure to launch refers to a syndrome wherein some children fail to leave home by age _____.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!