1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlabodo [156]
3 years ago
14

What’s the value for 2.3 + 4.09 =n

Mathematics
1 answer:
Rashid [163]3 years ago
6 0
Answer:

n = 6.39

Explanation:

2.3 + 4.09 = n
6.39 = n

Swap the sides of the equation
n = 6.39
You might be interested in
What is the value of y?
prohojiy [21]

Answer:

<h2>C. 54°</h2>

Step-by-step explanation:

We know: measures of angles in a triangle add up to 180°.

Therefore we have the equation:

\gamma+\gamma+72^o=180^o      <em>subtract 72° from both sides</em>

2\gamma=108^o       <em>divide both sides by 2</em>

\gamma=54^o

4 0
3 years ago
Write the standard form of the equation of the line through the given point with given slope
Lunna [17]
75) y=mx+b. plug in slope and point
2=(3/2)(1)+b
2=(3/2)+b. solve for b
b=1/2. plug back into original question
y=(3/2)x+(1/2) multiply by 2 to get rid of fraction
(y=(3/2)x+(1/2))*2.
2y=3x+1. subtract over the 3x
-3x+2y=1
Same would be done with the other 4 problems.
6 0
3 years ago
Can someone please check my answer????
Svetlanka [38]
Yes good job!! the one you picked is correct
8 0
3 years ago
What is the slope of the line that passes through the points (3, -2) and (9, -2)?
Crazy boy [7]
The answer is B. 0
when it’s a straight horizontal line, the slope is always going to be zero. It’s only going to undefined if the line is vertical.
6 0
3 years ago
Read 2 more answers
How long will it take for the balance of an account to double if the savings account earns 0.75% annual interest compounded mont
evablogger [386]
2p=p(1+0.0075/12)^12t
12t=log(2)/log(1+0.0075/12)
Can you solve for t
5 0
4 years ago
Other questions:
  • I need help on this question plz
    14·2 answers
  • Which statements are true? Check all that apply.
    14·2 answers
  • Solve the equation. 49+b^2=625.
    5·1 answer
  • A large diamond with a mass of 4289.6 grams was recently discovered in a mine. If the density of the diamond is 3.51 grams over
    7·2 answers
  • Which equation has slope of 1/2 and y intercept of -5
    12·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Is this right? Im trying to make sure i get this correct so could you guys please help me tysm very much appreciate it.
    14·1 answer
  • What is the area of this?
    12·1 answer
  • Mr. Strand mowed 2/5 of his lawn. His son mowed 1/4 of it. Who mowed most of the lawn? How much of the lawn still needs to be mo
    7·2 answers
  • Simplify -121<br> O-111<br> O 11<br> O-11<br> O 11
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!