Plant products duh(im a vegetarian)
its actually really healthy and is quite easy once u get the hang of it. u end up eating more veggies then u might want but it really healthy and benfits you more than the meat does. ive been a vegetarian forever (never eaten meat before ever) and im athletic and everything just like any other meat eater
Answer:
Mahir noticed the plant he watered grew taller than those with less water
Explanation:in the process of the scientific method,an observation about an occurrence happens first before an hypothesis is formulated and tested .
Observation usually involves the the description of a phenomenon.
Chemical methods--It includes ion exchange, precipitation, oxidation and reduction, and neutralization.........
Thermal methods--In this, high-temperature incineration, which not only can detoxify certain organic wastes but also can destroy them....
Biological treatment-- It is of certain organic wastes, such as those from the petroleum industry by a special method called landfarming
Physical treatment-- It concentrates, solidifies, or reduces the volume of the waste. Physical processes include evaporation, sedimentation, flotation, and filtration....
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
