1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maria [59]
3 years ago
11

What contains more types of plants and animals than anywhere else on earth deserts tropical rainforests?

Biology
1 answer:
lawyer [7]3 years ago
4 0
Answer:  [B]:  "tropical rainforests" .
_____________________________________________________
You might be interested in
What is an example of an elevation change
Olegator [25]

<em>For example,</em>

<em> consider a mountain whose summit is 5,000 feet (1,500 m) in elevation, but somewhere on the way up, the trail goes back down 250 feet (76 m). ... </em>

<em>If one hikes over five hills of 100 vertical feet each, the cumulative elevation gain is 5 × (100 feet (30 m)) = 500 feet (150 m).</em>

<em />

5 0
2 years ago
What is the hardness of copper and aluminum
Charra [1.4K]
Aluminum is 15 and copper is 35
7 0
3 years ago
What goes into the photosystems and what comes out of the systems. where will these products go?
Elanso [62]
Carbon goes in oxygen comes out and the oxygen goes into animals and carbon come out of animals
6 0
3 years ago
Read 2 more answers
What term is used to describe 100’s or 1000’s of amino acids chemically combined?
hjlf

Answer:

Polypeptide

Explanation:

Amino acids are the building block and simplest unit of protein molecules. The structural composition of each amino acids is made up of an amine group (-NH2), a carboxylic acid group (-COOH), a hydrogen atom (H) and a R side chain that differentiates every amino acid from one another.

In a reaction process called condensation, amino acids are chemically joined together via the amine group of one and the carboxylic group of another. This process releases water molecule (H20) to form a bond called PEPTIDE bond between the amino acids. Several amino acids in their 100’s or 1000’s that are chemically joined this way forms a POLYPEPTIDE chain, which in turn forms the protein molecule.

8 0
3 years ago
Science is always changing and never completely proves anything because _______ is part of the scientific process
Slav-nsk [51]
<span>Science is always changing and never completely proves anything because </span>uncertainty <span>is part of the scientific process </span>

6 0
3 years ago
Other questions:
  • What kind of plant would you most likely find in the desert​
    15·2 answers
  • What does DNA contain?
    7·2 answers
  • People who study the effects of human activities on Earth’s land, air, water, and living things are a. astronomers. b. environme
    6·2 answers
  • What do you get when you cross a fast dog with a bumblebee?
    8·1 answer
  • You tested for the presence of four different<br> by adding<br> three test tubes<br> to the<br> DONE
    10·2 answers
  •  ________is a way to calculate the age of an organic object by measuring the proportion of carbon-14 present.
    15·1 answer
  • Rational design requires:
    13·2 answers
  • The type of RNA that ribosomes are made of.
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Que funcion realiza la celula vegetal que la aninal no podria realizar​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!