1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ExtremeBDS [4]
3 years ago
12

True or false - DNA and RNA store heredity to make proteins?

Biology
1 answer:
anastassius [24]3 years ago
4 0

in my own opinion I think it's false ..,

You might be interested in
When water and mercury are placed in glass tubes, the water in the right tube)
Snowcat [4.5K]
No se ha dado el problema que han dicho nada de la gente de la policía y que no han dicho nada de la gente de la cara de de que se ha dado un paso de recoger y que no pueda ver el partido del
5 0
3 years ago
Read 2 more answers
Select ALL the correct answers.
tekilochka [14]

Answer:

(b) The interquartile range of B is greater than the interquartile range of A.

(d) The median of A is the same as the median of B.

Explanation:

Given

A = \{1, 4, 2, 2, 3, 1, 1, 2, 1\}

10th\ run = 9

So:

B = \{1, 4, 2, 2, 3, 1, 1, 2, 1,9\}

Required

Select all true statements

(a) & (d) Median Comparisons

A = \{1, 4, 2, 2, 3, 1, 1, 2, 1\}                         B = \{1, 4, 2, 2, 3, 1, 1, 2, 1,9\}

n = 9                                                         n = 10

Arrange the data:

A = \{1, 1, 1, 1, 2, 2,  2,3, 4\}               B = \{1,1,1,1,2,2,2,3,4,9\}

                               Median = \frac{n + 1}{2}th

Median = \frac{9 + 1}{2}th                            Median = \frac{10 + 1}{2}th

Median = \frac{10}{2}th                              Median = \frac{11}{2}th

Median = 5th                                 Median = 5.5}th --- average of 5th and 6th

Median = 2                                    Median = \frac{2+2}{2} = 2

Option (d) is correct because both have a median of: 2

(b) & (c) Interquartile Range Comparisons

A = \{1, 1, 1, 1, 2, 2,  2,3, 4\}               B = \{1,1,1,1,2,2,2,3,4,9\}

n = 9                                                         n = 10

First, calculate the lower quartile (Q1)

Q_1 = \frac{n + 1}{4}th[Odd n]             Q_1 = \frac{n}{4}th [Even n]

Q_1 = \frac{9 + 1}{4}th                            Q_1 = \frac{10}{4}th

Q_1 = \frac{10}{4}th                              Q_1 = 2.5

Q_1 = 2.5th                              

This means that:

Q_1 = 2nd + 0.5(3rd - 2nd)              Q_1 = 2nd + 0.5(3rd - 2nd)

Q_1 = 1 + 0.5(1- 1)                   Q_1 = 1+ 0.5(1 - 1)                      

Q_1 = 1                                       Q_1 = 1

Next, calculate the upper quartile (Q3)

Q_3 = \frac{3}{4}(n + 1)th [Odd n]             Q_3 = \frac{3}{4}(n)th [Even n]

Q_3 = \frac{3}{4}(9 + 1)th                            Q_3 = \frac{30}{4}th

Q_3 = \frac{30}{4}th                                     Q_3 = 7.5th  

Q_3 = 7.5th                                    

This means that:

Q_3 = 7th + 0.5(8th- 7th)           Q_3 = 7th + 0.5(8th- 7th)

Q_3 = 2 + 0.5(3- 2)                       Q_3 = 2+ 0.5(4 - 2)                      

Q_3 = 2.5                                       Q_3 = 3

The interquartile range is  IQR = Q_3 - Q_1

So, we have:

IQR = 2.5 - 1                  IQR = 3 - 1

IQR = 1.5                       IQR  =2

(b) is true because B has a greater IQR than A

(e) This is false because some spread measures (which include quartiles and the interquartile range) changed when the 10th data is included.

The upper quartile and the interquartile range of A and B are not equal

8 0
3 years ago
Which type of organism feeds on dead organisms whilst respiring to release carbon dioxide into the atmosphere
Serggg [28]

Answer:

decomposers

Explanation:

6 0
2 years ago
Rust on rocks is it a Mechanical or<br> chemical
bonufazy [111]
The correct answer is Chemical. Because two substances are reacting and creating a new substance.

4 0
3 years ago
Identify the true statement about the head of the ulna. a. Found at the distal end of the bone. b. Helps form the elbow joint. c
nataly862011 [7]

Answer:

A

Explanation:

The head of the ulna is found at the distal end of the bone.

8 0
3 years ago
Other questions:
  • Small openings called vacuoles allow carbon dioxide to enter a leaf.<br> TRUE OR FALSE
    14·2 answers
  • Which situation does not illustrate kinetic energy?
    6·2 answers
  • Science test pls help.
    15·2 answers
  • Neurons are part of a(n) _________ system. A sturdy B social C independent D complex
    10·1 answer
  • Name the three types of blood cells?
    5·2 answers
  • How do erosion and deposition work together to form sand dunes?
    13·1 answer
  • Knowing that chaparral biomes are comprised mostly of low-growing shrubs, what adaptations have sage, rosemary, thyme, and orega
    8·2 answers
  • Are a group of cells that work together to perform a specific function.
    7·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • How is asexual reproduction advantageous to an organism while still putting it at a disadvantage?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!