1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Komok [63]
3 years ago
13

HELP PLEASE!! (100 points)

Chemistry
1 answer:
MrRa [10]3 years ago
3 0

Answer:

As you cool a matter to absolute zero, their kinetic energy reduces significantly and the molecules slows down and begins to aggregate together. ... As heat is added, the molecules gain more kinetic energy. This shown in their increase motion. When heat is withdrawn, the particles slows down hope this helped

You might be interested in
Covalent bonds take place between..
umka2103 [35]

Answer:

Covalent Bonds are formed when two non-metals share electrons

Hope this helps

7 0
3 years ago
How many atoms are in 1.75 mol CHCL3
vaieri [72.5K]

1 mol = 6.022 x 10²³ atoms

In order to find how many atoms, dimly multiply the amount of moles you have by 6.022 x 10²³ or Avogadro's number.

So you have 1.75 mol CHC1₃ x (6.022x10²³) = 1.05385 x 10²⁴ atoms of CHCl₃

But now you have to round because of the rules of significant figures so you get 1.05 x 10²⁴ atoms of CHCl₃

6 0
3 years ago
Read 2 more answers
Calculate the missing variables in each experiment below using Avogadro’s law.
blagie [28]

Answer:

The answer to your question is: letter c

Explanation:

Data

V1 = 612 ml    n1 = 9.11 mol

V2 = 123 ml    n2 = ?

Formula

                               \frac{V1}{n1}  =  \frac{V2}{n2}

                                         n2 = \frac{n1V2}{V1}

                                         n2 = \frac{(9.11)((123)}{(612)}

                                                n2 = 1.83 mol                                                

5 0
3 years ago
Which substance is the reducing agent in this reaction? 2KMnO4+3Na2SO3+H2O→2MnO2+3Na2SO4+2KOH
olganol [36]
I believe <span>Na2SO3  is the solution to the problem.</span>
6 0
3 years ago
Read 2 more answers
Ling decided to do a science project on exercise. She wanted to find out how long it takes for a person's heart rate to slow dow
forsale [732]
C- a persons heart rate slows down after 5 minutes.
8 0
4 years ago
Other questions:
  • What do a prism, a magnifying glass, a microscope, and eyeglasses ALL have in common?
    9·2 answers
  • What is the electron structure of a beryllium ion with a net ionic charge of +2?
    7·1 answer
  • What is term redox reaction
    14·2 answers
  • Which combination of elements below will bond ionically and in the same ratio as lithium when it bonds to sulfur?
    15·2 answers
  • Which of the following is a pure substance?
    5·1 answer
  • A warm front moves into a region. What kind of weather most likely results?
    7·2 answers
  • A molecule with a single covalent bond is _____. co cl2 co2 n2
    7·2 answers
  • Indicate the number of unpaired electrons for following: [noble gas]ns2np5
    10·2 answers
  • Which spheres are interacting when a volcano irrupt and gas is released into the air
    11·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!