1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leokris [45]
3 years ago
7

What part of the digestive system absorbs nutrients that our bodies need?

Biology
2 answers:
-Dominant- [34]3 years ago
7 0

Answer:

B. small intestine

Explanation:

Small intestine absorbs the nutrients that our bodies need.

Mama L [17]3 years ago
5 0

Answer:

small intestine

.

is the correct answer

You might be interested in
Do rainforests have seasons?  if do What are they?
Serjik [45]
Wet season and dry season ♥️
5 0
4 years ago
Read 2 more answers
Which natural selection condition example can be classified as over production of offspring?
Tatiana [17]
Natural selection is the process by which individuals with characteristics that are advantageous for reproduction in a specific environment leave more offspring in the next generation, thereby increasing the proportion of their genes in the population gene pool over time. Natural selection is the principal mechanism of evolutionary change, and is the most important idea in all biology. Natural selection, the unifying concept of life, was first proposed by Charles Darwin, and represents his single greatest contribution to science.

Natural selection occurs in any reproducing population faced with a changing or variable environment. The environment includes not only physical factors such as climate or terrain, but also living factors such as predators, prey, and other members of a population.

Mechanism of Natural Selection

The mechanism of natural selection depends on several phenomena:

• Heredity: Offspring inherit their traits from their parents, in the form of genes.

• Heritable individual variation: Members of a population have slight differences among them, whether in height, eyesight acuity, beak shape, rate of egg production, or other traits that may affect survival and reproduction. If a trait has a genetic basis, it can be passed on to offspring.

• Overproduction of offspring: In any given generation, populations tend to create more progeny than can survive to reproductive age.

• Competition for resources: Because of excess population, individuals must compete for food, nesting sites, mates, or other resources that affect their ability to successfully reproduce.

Given all these factors, natural selection unavoidably occurs. Those members of a population that reproduce the most will, by definition, leave more offspring for the next generation. These offspring inherit their parents' traits, and are therefore also likely to succeed in competition for resources (assuming the environment continues to pose the same challenges as those faced by parents). Over several generations, the proportion of offspring in a population that are descended from the successful ancestor



Uloborid spider eggs and spiderlings. In any given generation, populations tend to create more offspring than can survive to reproductive age.

increases, and traits that made the ancestor successful therefore also increase in frequency. Natural selection leads to adaptation, in which an organism's traits conform to the environment's conditions for existence.

5 0
3 years ago
A laboratory procedure calls for heating 50 milliliters of a sugar of a sugar solution to 60°C. Which piece of laboratory equipm
Rina8888 [55]
A ruler will not be needed due to having a graduated cylinder which can help measure the volume of liquids
4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
which is an example of an acquired trait? A the ability to hear B the ability to write C color vision D body hair
makkiz [27]
B . ability to write
5 0
4 years ago
Read 2 more answers
Other questions:
  • Kari bought 3 boxes of cookies to share with a book club. Each box contains 12 cookies. The expression mr023-1.jpg represents th
    5·2 answers
  • Which describes the habitat of a frog?
    5·2 answers
  • A major misconceptionabout natural selection is that this mechanism "gives orginisms what they want or need so they can adapt to
    7·2 answers
  • Explain why bullying takes lives and why it is so important to be an upstander
    15·1 answer
  • In which zone are turbidity currents found? What are these currents, how do they flow, and what causes them?
    6·1 answer
  • When animals evolve due to their environment they can become a new?
    15·1 answer
  • 1. Describe a flood caused by a rising river. What might cause this?
    14·1 answer
  • Which of the following statements about bioremediation is FALSE?
    6·1 answer
  • Can parents with A and B blood type have a baby of O <br>if yes please state reason ​
    13·1 answer
  • Which trait/s did the common ancestor<br> of Lizards and Chimpanzees NOT have?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!