1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hoa [83]
3 years ago
5

1. To be regarded as safe, a sewage system must

Biology
1 answer:
wel3 years ago
6 0

Answer:

c

Explanation:

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Females developing wider hips and males developing facial hair are examples of
Alexeev081 [22]
It would be puberty or secondary sexual characteristics
3 0
3 years ago
Does anybody know the answer to this question please help me 10 more minutes
bija089 [108]

Answer:

The answer is number two extinction happened, this was the time dinosaurs went extinct ebcause lack of sun because oh how much dirt was blown into the earth atmosphere becuase of the asteriod, third option is talking about big bang theroy so that dosnt apply!

Explanation:

3 0
3 years ago
How many shape forms of viruses are there?
elena55 [62]
There are three basic shapes
5 0
3 years ago
What is the main function of a selectively permeable cell membrane?
BabaBlast [244]
The main purpose is protection. The lipid bilayer protects the cell from viruses and other threats to the cell. It also maintains homeostasis within the cell by monitoring the amount of substances the enter or exit the cell. 
5 0
3 years ago
Other questions:
  • Identifying an individual’s genetically influenced health risks could increase their potential to achieve optimal health. TRUE O
    13·1 answer
  • Predict biodiversity changes that would be expected to occur in response to changing environmental factors
    13·1 answer
  • Compare the element hydrogen with the alkali metal sodium
    5·2 answers
  • Name one reason why a controlled experiment may not be possible
    15·1 answer
  • .a i What does a food chain mean to you?
    7·2 answers
  • Sex cells in humans contain ______ chromosomes and an example is _________.
    15·2 answers
  • Which of the following sequences is in the correct order? ETC
    13·1 answer
  • What do you think could happen to the enzyme lactase at the end of the reaction
    7·1 answer
  • The energy in living things on Earth
    15·1 answer
  • How does plant with particulate matter affect the economy
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!