1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nastasia [14]
3 years ago
7

4x4 Thhhhhhaaannkkkk uuuuu

Mathematics
2 answers:
olga nikolaevna [1]3 years ago
8 0

Answer:

16

Step-by-step explanation:

4+4+4+4

     or

8+8

dolphi86 [110]3 years ago
8 0

Answer:

16

Step-by-step explanation:

You might be interested in
Kim is drawing a map of the different schools in her school district. She knows that her middle school is 10.6 miles away from t
Natalija [7]
5.5 inches away on the map. 

7 0
3 years ago
How to find the diameter of a circle using the circumference?
Zolol [24]
    
\displaystyle\\
\texttt{Circumference }=  \pi \times \texttt{ Diameter}   \\  \\ 
\Longrightarrow ~~~\boxed{\texttt{ Diameter}  =  \frac{\texttt{Circumference }}{\pi} }



5 0
4 years ago
Can you Factorise 22 + 10x
Rufina [12.5K]

=> 22+10x

=> 2(5x+11)

This is the answer for your question

5 0
3 years ago
Read 2 more answers
Find the sum using front end estimation.
dlinn [17]

Answer:

1690 (C)

Step-by-step explanation:

Just Add

237

549

904

--------

1690

8 0
4 years ago
Help please!! (attachment below)
Aleksandr-060686 [28]

It’s function one cause if you find the slope on the table it’s 3/1 which is basically just 3. Then the y-intercept is -3.

Function 1 slope is 5 or 5/1 and y-intercept is 4

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these numbers are less than 8.1 × 10-8?
    7·1 answer
  • How do I get better at algebra 2
    8·2 answers
  • Please help me on this <br><br> Simplify (12^2)^4
    12·1 answer
  • Whoever has the best answer gets the brainliest!!:)
    6·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • A grease gun holds a cylindrical tube of grease that is 14 in. long and has a radius of 1.5 in. With each squeeze, 15 in3 of gre
    14·1 answer
  • HELP ME Please i beg you can you help me!!!!
    13·1 answer
  • List the sides of the triangle in order from<br> shortest to longest.
    15·2 answers
  • Sarah's Volleyball team won 12 out of 14 games if this rate continues, how many games will they win if they play a total of 21 g
    9·1 answer
  • Solve for 2. Round to the nearest tenth of a degree, if necessary.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!