1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crank
3 years ago
15

Explain what happens to the average kinetic energy thermal energy and temperature of a substance when the particles in the subst

ance slows down
Chemistry
2 answers:
kkurt [141]3 years ago
8 0
The average kinetic energy and thermal energy decreases, and the temperature decreases as well.
vivado [14]3 years ago
8 0

The particles in a substance slow down when the average kinetic energy of the particles decreases. As the average kinetic energy decreases, the internal energy decreases, and so the thermal energy decreases. As the thermal energy of the substance decreases, the temperature decreases.

You might be interested in
Symbols used in equations, together with the explanations of the symbols, are shown below. which set is correct?
vaieri [72.5K]
Number 4 : solid product
3 0
2 years ago
Read 2 more answers
To find the number of atoms look at the number known as the________. Please help.
Rufina [12.5K]

Answer:

molar mass or AMU

Explanation:

4 0
2 years ago
The unit cm3 is used to express
sergij07 [2.7K]
It expresses a cube using cm
3 0
3 years ago
When you light a fireplace what energy transformation occurs?
snow_tiger [21]
<span>thermal energy

hope this helped</span>
4 0
3 years ago
What is the definition of lead in chemistry
abruzzese [7]

Answer:

Lead is a chemical element with the symbol Pb (from the Latin plumbum) and atomic number 82. It is a heavy metal that is denser than most common materials. Lead is soft and malleable, and also has a relatively low melting point.

Explanation:

6 0
3 years ago
Other questions:
  • Two advantages of using hydrogen to fuel cars
    9·1 answer
  • For the reaction
    13·2 answers
  • If the alum reaction was done starting with 12.000 g of al, how many moles of hydrogen gas would be produced according to the ba
    9·1 answer
  • Which statement describes a controlled experiment? A.) It has one group in which the controlled variable is tested, and another
    9·1 answer
  • Which alignment of the Sun, Moon, and Earth causes a lunar eclipse?
    12·2 answers
  • Cold packs, whose temperatures are lowered when ammonium nitrate dissolves in water, are carried by athletic trainers when trans
    6·1 answer
  • Something used to power some devices.
    8·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Phosphorus trichloride reacts with chlorine to form phosphorus pentachloride.
    12·1 answer
  • Consider the balanced equation below.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!