1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mina [271]
2 years ago
15

Neither whales nor pythons have hind legs, but both have internal remnants of legs and hip bones. Snakes and whales must have I.

evolved from ancestors that walked. II. developed morphological adaptations for transportation. III. had their legs bitten off by their mothers at birth.
Biology
1 answer:
alexandr402 [8]2 years ago
4 0

Answer:

I. evolved from ancestors that walked

Explanation:

Whales and pythons have vestigial structures, which are structures (hind legs) which are no longer useful to them since they have evolved. The ancestors of the whale and python did use the hind legs but over generations the whale and snake have adapted to new environments and they no longer need them.

You might be interested in
The scientific name of a living thing is made up of its genus and _____ names.
Elanso [62]
Species.
The scientific name is in the form genus species.
8 0
3 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
CORRECT ANSWER WILL RECIEVE A MARK OF "THE BRAINLIEST ANSWER" Thanks so much! :)
mina [271]
It adds bases in only one direction.
6 0
3 years ago
Read 2 more answers
Which is the correct order of organisms in terms of their appearance on Earth?
amid [387]
<span>coacervates > heterotrophic prokaryotes > chemosynthetic prokaryotes > photosynthetic</span>
4 0
3 years ago
Read 2 more answers
Write in brief about siluroid fish. ....5 marks question ​
erastovalidia [21]
It is a fish of Oder that compromises catfishes.
8 0
2 years ago
Other questions:
  • Of the acids in the table below, ________ is the strongest acid. question 6 options:
    5·1 answer
  • The Basin and Range region in the western United States is aptly named because _____.
    9·2 answers
  • I would really appreciate it if you help me.
    11·2 answers
  • Q2.25. Assume that early in the summer, the only prey available are stoneflies and caddisflies. If the search time for its prefe
    14·1 answer
  • How could a substance that stops the synthesis of mRNA cause the liver to stop functioning (the death of liver cells)?
    5·2 answers
  • Can anyone list The Major greenhouse gases
    12·2 answers
  • During which era did the first fish evole
    12·1 answer
  • (a) Identify the given figures A and B<br> (b) Describe the role performed by the two.
    6·1 answer
  • What do you mean by photo synthesis​
    15·2 answers
  • Cell membrane and movement across the Membrane.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!