1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inysia [295]
3 years ago
15

You are a wild rabbit and your species currently lives in desert. Most of the rabbits are brown but there are a few that are whi

te. An asteroid hits the Earth and the environment you live in suddenly becomes very cold. It begins to snow leaving snow covering the ground. Will your species be able to adapt and line in the new environment? Explain and give details (what happens to white rabbits and brown rabbits.)
I need the brainylest answer and I will give a brainylest answer for this.​
Biology
1 answer:
Katena32 [7]3 years ago
3 0

Answer:

The species of wild rabbits that are brown would most likely have a harder time adapting than the white rabbits to the new environment.

Explanation: The brown rabbits are going to have a hard time living in the snow mostly because of their color. The brown rabbit is more likely to be able to live in the desert because they can camouflauge with their surroundings (the sand). Therefore, camouflaging in the white snow to escape a predator would be impossible for brown rabbits, since they could easily be spotted. Furthermore, the white rabbits would have a higher chance of survival since they can camouflage easier in the snow.

You might be interested in
Select from the drop-down menu to correctly complete the statement. Organs combine to form... Plz help​
tatyana61 [14]

Answer:

An Organ system

Explanation:

6 0
3 years ago
Read 2 more answers
The organisms at the beginning of a food chain are
finlep [7]
Producers. They’re usually producers.
6 0
3 years ago
1. Why is the water molecule so important to organisms?
Oksana_A [137]

Answer:

the waters acts as a solvent for chemical reactions and also helps transport dissolved compounds in and out of cells.

6 0
3 years ago
Plz help me well mark brainliest if correct!!
sammy [17]

Answer:

B)

Explanation:

The Greenhouse effect occurs when heat from pollution is trapped in Earth's atmosphere.

3 0
3 years ago
What is one result of warming up your body’s muscles before exercising?
Scrat [10]
By warming up your muscles (I am assuming you mean by stretching and doing jumping jacks and such, not sitting yourself in front of a heater...) you will have a better overall workout. Your muscles will be ready to work and you will not tire as fast. Also, your muscles will feel better the next day because you got them ready to work out.
7 0
3 years ago
Read 2 more answers
Other questions:
  • What inference can correctly be drawn from the diagram shown below? (2 points) Image depicts four very similar birds with slight
    5·2 answers
  • One function of the central vacuole in plant cells is facilitating cell growth: the central vacuole absorbs water and increases
    7·1 answer
  • How are potatoes made?
    15·2 answers
  • How does the whole sporophyte/gametophyte generations thing work? This just does not make sense to me...
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • A bowling ball hitting pins and they fly backwards whicch <br> Newton’s law
    6·2 answers
  • If a limiting nutrient is supplied to the producer in the diagram above, what effect could it have on the birds?
    7·1 answer
  • I got scammed last time I asked can you guys help me now pls<br><br><br><br><br> She/They
    7·1 answer
  • Earthworms help farmers. Many farmers add them to their farmland because they help form rich soil to grow crops in.
    7·1 answer
  • Many hockey sticks are made of composite materials instead of wood. How would you classify each type of hockey stick?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!