1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fofino [41]
3 years ago
13

Two parents think their baby was switched at the hospital. Its 1968, so DNA fingerprinting technology does not exist yet. The mo

ther has
blood type "o," the father has blood type "A," and the baby has blood type "0."
No chance at all that the baby is theirs.
The baby could be theirs it mom's blood genotype is BU
The baby could be theirs it mom's blood genotype is heterozygous O.
The baby could be theirs il dad's blood genotype is heterozygous A.
Biology
1 answer:
Hunter-Best [27]3 years ago
5 0

Answer:

No chance the baby is theirs.

Explanation:

using a Punnett square, you could only get blood type A from the parents.

You might be interested in
Which step in PCR (polymerase chain reaction) is responsible for opening and unwinding the DNA strand to be analyzed?
Fofino [41]
Denaturing. This step occurs at around 95C. This causes the double strand Helix to spectate
6 0
3 years ago
Which of these is an example of genetic modification?
poizon [28]
I believe the answer is gene splicing
7 0
3 years ago
Is this right i’m confused?
tatiyna
Mark Brainliest please

Answer:

I think answer is 3. Disposable syringes and blood tube

Hazardous medical waste that needs to be carefully disposed of by incineration. Items include clinical waste such as used syringes and needles, used swabs, plasters and bandages.
7 0
3 years ago
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
3 years ago
What provides the body with the most energy
Roman55 [17]
Carbohydrates, proteins, and fats.
6 0
3 years ago
Other questions:
  • What is the define for infection
    5·1 answer
  • New Zealand has a population of 4,326,380 and has an area of 103,736 mi2028-02-04-03-00_files/i0370000.jpg while Australia has a
    12·2 answers
  • The pancreas contains exocrine cells that secrete digestive enzymes into the _______ , and clusters of endocrine cells called pa
    9·1 answer
  • The nurse is providing home care instructions to the client who just had surgery for squamous cell carcinoma. the nurse provides
    5·1 answer
  • Explain why the process of mitosis is importance in cells
    10·1 answer
  • The rest of the group agrees with your conclusion that Dr. Tamm was likely exposed to a membrane uncoupling agent. Uncoupling ag
    11·1 answer
  • When a cel is placed in this type of solution, there will be equal amounts of water moving in and out of the cell at equal rates
    7·2 answers
  • Select the correct answer
    13·2 answers
  • Identify an area on Earth that has a high level of biodiversity, and the correlation with threats to various species.
    6·2 answers
  • What is the best way to reboard a PWC in the water from the front of the PWC over the bow pull it to shore with a rope and then
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!