Denaturing. This step occurs at around 95C. This causes the double strand Helix to spectate
I believe the answer is gene splicing
Mark Brainliest please
Answer:
I think answer is 3. Disposable syringes and blood tube
Hazardous medical waste that needs to be carefully disposed of by incineration. Items include clinical waste such as used syringes and needles, used swabs, plasters and bandages.
It should be
AGATACCATGGTTACCCGGTTCCA
Carbohydrates, proteins, and fats.