1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kramer
3 years ago
8

Meiosis and Mutations are both sources of/for:

Biology
1 answer:
devlian [24]3 years ago
6 0

Answer:

genetic drift

please mark as brainlest

You might be interested in
The economy of agrarian society is based on which of these activities
AleksandrR [38]

Answer: Farming

Explanation: Plowing the land is the  first source of wealth.

7 0
3 years ago
An ice fisherman has fallen through the ice. In response to the cold water, sensors in the man's skin send a "cold" signal to th
Svet_ta [14]

Answer:

Hypothalamus

Explanation:

The hypothalamus is a part of the brain which possesses temperature receptor cells that detect changes in the man’s temperature, thereby sending signals in the form of electrical nerve impulses to the man’s muscles and nervous system, which in turn respond in counteracting the drop in the normal temperature of the body.  

Once the muscle cells of this man receive these signals, they produce heat through thermogenesis by shivering when the muscle cells begin to contract. This is one of the mechanisms by which thermoregulation is achieved as controlled by the hypothalamus in the brain of the man.

6 0
3 years ago
How are proteins related to traits?
mash [69]

Answer:

the relationship between genes, proteins, and traits a gene codes for a particular protein that is involved in the expression of a trait

Explanation:

characteristics determined by single genes are called Mendelian traits

3 0
3 years ago
The drawing below illustrates a small portion of the molecules that make up a cell membrane. What is the primary function of the
Ket [755]

Answer:

The correct option is b

Explanation:

Phospholipids are lipids that contains a phosphate group, which forms the "head" of the molecule and is hydrophilic (water loving). The "tail" of phospholipids is made of two fatty acids which are hydrophobic (water fearing). The phospholipid in the cell membrane acts as a selectively permeable barrier that regulates what goes in and out of the cell <u>thereby protecting the cell from some external molecules and ions</u>.

7 0
3 years ago
What information is given in the MSDS for acetic acid? the mass of acetic acid that is consumed in an experiment the volume of a
marissa [1.9K]

Answer:

The reactivity of acetic acid with various chemicals.

8 0
2 years ago
Read 2 more answers
Other questions:
  • Cells that become gametes are called ______ cell lines.
    12·2 answers
  • What type of seizure starts in the fingers and progressively spreads up the arm and extends to the leg?
    11·1 answer
  • A. True <br> b. False: decision structures are also known as selection structures.
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • One parent is heterozygous for type B blood. The other parent has type AB blood. Which fraction of their children will
    5·1 answer
  • Types if fruit and seed dispersal
    11·2 answers
  • Which type of precipitation may contain acidic pollutants?
    15·1 answer
  • Why do i suck at biology
    5·1 answer
  • Which two fit?
    12·1 answer
  • The force required to prevent the movement of water across a selectively permeable membrane is __________ pressure
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!