1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
professor190 [17]
3 years ago
12

a chemical reaction produced 2.50 moles of nitrogen gas. what volume in liters, does this gas sample occupy at STP? (show your w

ork)
Chemistry
1 answer:
Harrizon [31]3 years ago
5 0

The volume of N₂ at STP=56 L

<h3>Further explanation</h3>

Given

2.5 moles of N₂

Required

The volume of the gas

Solution

Conditions at T 0 ° C and P 1 atm are stated by STP (Standard Temperature and Pressure). At STP, the volume per mole of gas or the molar volume-Vm is 22.4 liters/mol.

So for 2.5 moles gas :

\tt 2.5\times 22.4=56~L

You might be interested in
Which substance is not a structural isomer of hexyne?
stich3 [128]

Answer:

c) 3,3-dimethylpent-1-yne

5 0
3 years ago
PLEASE HELP ME I BEG PLEASE!!!!
cricket20 [7]
1.Decomposition i think
2.boiling
3.It is a solid at room temperature and pressure.
4.<span>The base donates a hydrogen ion.
5.That causes the oxidation of another element
6.</span>MnO2
7.When a substance is reduced, electrons are lost.
8.True I think
9.False
10.True

Hope these are correct
3 0
3 years ago
Read 2 more answers
Calculate the mass percent composition of sulfur in Al2(SO4)3.
Anastaziya [24]
The molar mass of aluminum sulftae is 342.14 g/mol.

Since the subscript shows that there are 3 sulfurs within the substance, the total mass of sulfur is 96.21g/mol

Now take the mass of the sulfur and divide it by the molar mass of aluminum sulfate, then multiply by 100:
(96.21/342.15)(100) = 28.1% mass composition of sulfate
6 0
3 years ago
What is a characteristic that can be observed or measured without changing the chemical makeup of a substance? *
olga55 [171]
The correct answer is B
4 0
3 years ago
Bacteria that live around deep-sea hot-water vents obtain energy by oxidizing inorganic hydrogen sulfide belched out by the vent
ElenaW [278]

Answer:

<h2>chemoautotrophs</h2>

Explanation:

Such types of bacteria that oxidize inorganic compounds to obtain energy and use carbon dioxide as a carbon source to synthesize their food are known as chemoautotrophs such as iron-oxidizing bacteria, cyanobacteria, sulfur-oxidizing bacteria and some other. Chemoautrophic mode of nutrition is a type of autotrophic nutrition in which organisms have the ability to synthesized their own food by using chemical energy in the place of solar energy. The organismS that use solar energy to synthesize their food are known as photoautotrophic organisms such as plants and some other organisms.

7 0
3 years ago
Other questions:
  • How much organic chemistry do i need to know for polymers?
    10·1 answer
  • What do the presence of fish and a wide diversity of invertebrates in a river indicate?
    8·1 answer
  • Carlos uses a machine to decrease his force Which of the following statements is true?
    12·1 answer
  • What type of reaction does this equation represent?<br><br> 2I4O9(s) → 4I2(s) + 9O2(g)
    15·1 answer
  • The primary gas in a volcano is: water vapor carbon dioxide sulfur dioxide nitrogen
    5·2 answers
  • Consider the reaction. X ( g ) + Y ( g ) − ⇀ ↽ − Z ( g ) K p = 1.00 at 300 K In which direction will the net reaction proceed fo
    13·1 answer
  • Assume that your empty crucible weighs 15.98 g, and the crucible plus the sodium bicarbonate sample weighs 18.56 g. After the fi
    9·1 answer
  • Examine the reaction equation.
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • PLEASE HELPPP ASAPPPP!!!!
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!