1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rom4ik [11]
3 years ago
9

Jeffry was wondering why when he made breakfast, that after he was done cooking, the mass of everything he used was not the same

. What best
describes why this is so, according to the law of conservation of mass.

A: cooking causes water vapor to escape so it cannot be added to the mass
B: cooking makes things solid and that adds to the mass
C: cooking changes the matter so it is different

D: cooking did nothing so he measured the mass wrong
Biology
1 answer:
Yuki888 [10]3 years ago
4 0

Answer:

the answer is b guys

Explanation:

cooking makes things solid and that adds to the mass

mark brainliest!

You might be interested in
An overly simplistic way to describe the brain is that the left side is the "_____" side, and the right side is the "_____" side
tamaranim1 [39]
<span>Our brain is divided into two halves, as most of us know: the left and right side. Each side processes information very differently than the other, and the biggest difference is the visual aspect. The right side of the brain looks at visual reference as a whole, whether it be a landscape, object, or piece of artwork, and then works its way into noticing finer details. The left side on the other hand, first sees the details and puts them together to form the bigger picture. In simple brain is that the left side is the "Organization and logic" side and right side is the "Visual reference " side.</span>
8 0
4 years ago
Manpower is the most important resource of an organization. Explain.​
melisa1 [442]

Answer:

Manpower planning is counted as the most important function of the human resource management of the organization. It helps in managing the maintenance of the business goodwill by providing value to the man, material, machine and money.

3 0
3 years ago
Why did people in England feel that it was reasonable that America paid more taxes?
Hatshy [7]

Answer:

See below

Explanation:

The people in England felt that it was acceptable to make to colonists pay taxes because they felt that they still owned the colonists and could push them around as they wished. They also needed the money to pay for war debt. It was also a reaction to the protests that the Americans were performing.

6 0
4 years ago
True-breeding pea plants have either spherical seeds or dented seeds with spherical being the dominant phenotype. A genetic cros
lana66690 [7]
A would be a good answer
5 0
3 years ago
PLEASE HELP I WILL MARK BRAINALISTTTT
Ira Lisetskai [31]

Answer:

22. is a

23. is b

Explanation:

carbohydrates are made up of carbon, hydrogen, and oxygen

hope this helps :) have a nice day !!

**please let me know if this was wrong**

5 0
3 years ago
Other questions:
  • The smallest functional unit of life is considered to be the ________.
    15·1 answer
  • Archaea are often described as hybrid organisms having some features that are similar to bacteria and some that are similar to e
    7·1 answer
  • Why is there no external male reproductive organ in a frog?
    6·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Two populations of birds live in the same area but have different sleep/wake cycles. this is
    13·1 answer
  • Chloroplasts cannot move on their own. How do they move around the cell?
    7·1 answer
  • Which jobs does an animal's skeletal system do?
    6·1 answer
  • How is it possible for us to have a genetic disease that your grandparents had/have but our parents never had it?
    12·2 answers
  • I’m literally on a timer rn I need this quick
    13·1 answer
  • One molecule of glucose makes 30 molecules of ATP. How many molecules of glucose are needed to make 6000 molecules of ATP in aer
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!