All categories

3 years ago

Which is not an example of mechanical energy used in power plants? *

Chemistry

2 answers:

zhuklara [117]3 years ago

7 0

Answer:

Gravity

Explanation:

Gravity is not a form of mechanical energy used in power plants

mr_godi [17]3 years ago

5 0

burninh fossil fuels is not an example

You might be interested in

What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG

valentina_108 [34]

TACCGAACGGTTCCAGGCCTTTCAAAG

3 0

3 years ago

What are six forms of energy? Find an example of each.

Evgesh-ka [11]

1-Electric Energy
Example: A lightbulb is an example of electric energy
2-Sound Energy
Example: When a dog barks, that is sound energy
3-Solar Energy
Example: When we use the sun for energy. Like using it to dry our clothes.
4-Chemical Energy
Example: An example is a battery. That may not seem like it, but it is Chemical Energy.
5-Nuclear Energy
Example: A fission reaction at a nuclear powerplant
6-Thermal Energy
Example: A pot of water boiling on an Electric Stove
~Silver

4 0

3 years ago

Calculate the moles of 12.354 grams of c6h12o6

gavmur [86]

The correct answer is 0.06857 moles.

C₆H₁₂O₆, that is, glucose has six carbons, twelve hydrogens, and six oxygen atoms. The atomic weight of C, H and O are as follows:

Six atoms of carbon = 6 × 12.01 g = 72.06 g

Twelve atoms of hydrogen = 12 × 1.008 g = 12.096 g

Six atoms of oxygen = 6 × 16.00 g = 96.00 g

So, the molar mass of C₆H₁₂O₆ is 72.06 g + 12.096 g + 96.0 g = 180.156 g.

It can also be written in the form as 180.16 g of C₆H₁₂O₆ is equal to 1 mole of C₆H₁₂O₆or 180.16 g/mole (as the molar mass)

Now, there is a need to find moles of 12.354 grams of C₆H₁₂O₆. So, the final conversion is:

12.354 g C₆H₁₂O₆ × 1 mole of C₆H₁₂O₆ / 180.16 g C₆H₁₂O₆

= 0.06857 moles

5 0

3 years ago

How does the properties of matter in liquid and gas state allow the Herons fountain to work?

Varvara68 [4.7K]

Answer:

Heron's fountain is an hydraulic machine that works because or the pressure inside of the system. Water will flow from high gravitational potential energy to low gravitational potential energy. The two sides of the system will present different pressure because they have different fluids in it (water and air) and water pressure is higher than gas/air pressure, so it will flow.

It is important to take into account that the pressure in the columns is a function of the height of the fluid (water or air).

Explanation:

The properties of liquid:

- If a liquid is poured into a container, it will adapt to the container's shape

- In a liquid state, the molecules have a kinetic energy higher than in a solid state

- Liquid particles are not arranged in a regular way but they are very close to each other, that's why liquids have a definite volume.

- Force is spread in an even way through a liquid, so the liquid particles are displaced if an object is placed in it.

- Liquids, as solids, can't be compressed

The properies of gas:

- They are everywhere

- Gas molecules are disorganized and have a great deal of space between them

- Gas fill up any container and spread indefinitely

- Gas molecules have a high kinetic energy

- If gas is put under pressure, the space between particles will decrease and collisions between them will increase.

- If the temperature of the gas increases in a container, the pressure will increase; if the temperature decreases, the pressure sill decrease.

- It can be compressed

- Gas has no definite volume nor definite shape.

8 0

3 years ago

If antique brass is 30.0% zinc and 70.0% copper, how many grams of antique brass can be made from 18.0 grams of zinc and 32.8 gr

wariber [46]

Answer: 51.86

Explanation:

3 0

2 years ago